Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601966608:

Variant ID: vg0601966608 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 1966608
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, G: 0.02, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:

AGATGTTGCTAATTTTTCTTTAAACTTCGTCAACTTAACAAAGTTTGACTAGAAAAAAAATCAAAACAACTTATATGAAACGGAGGAGTAGTAGAAAAAA[C/G]
GGTTTTCACAAGCACCCCCTAATTGCACAGGCGGCATAGTGCCACTGCCTGTGCAGTACATCTAAAGAGTAGTGGGTGTGTCATTGCGTGAAAGATCGGT

Reverse complement sequence

ACCGATCTTTCACGCAATGACACACCCACTACTCTTTAGATGTACTGCACAGGCAGTGGCACTATGCCGCCTGTGCAATTAGGGGGTGCTTGTGAAAACC[G/C]
TTTTTTCTACTACTCCTCCGTTTCATATAAGTTGTTTTGATTTTTTTTCTAGTCAAACTTTGTTAAGTTGACGAAGTTTAAAGAAAAATTAGCAACATCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.30%	24.40%	0.23%	0.00%	NA
All Indica	2759	58.50%	41.20%	0.33%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	13.90%	85.50%	0.50%	0.00%	NA
Indica II	465	74.40%	25.40%	0.22%	0.00%	NA
Indica III	913	79.00%	20.80%	0.22%	0.00%	NA
Indica Intermediate	786	58.90%	40.70%	0.38%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	83.30%	14.40%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0601966608	C -> G	LOC_Os06g04540.1	upstream_gene_variant ; 3028.0bp to feature; MODIFIER	silent_mutation	Average:32.891; most accessible tissue: Zhenshan97 root, score: 54.262	N	N	N	N
vg0601966608	C -> G	LOC_Os06g04550.1	upstream_gene_variant ; 2017.0bp to feature; MODIFIER	silent_mutation	Average:32.891; most accessible tissue: Zhenshan97 root, score: 54.262	N	N	N	N
vg0601966608	C -> G	LOC_Os06g04540-LOC_Os06g04550	intergenic_region ; MODIFIER	silent_mutation	Average:32.891; most accessible tissue: Zhenshan97 root, score: 54.262	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0601966608	NA	8.93E-14	Grain_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0601966608	NA	5.36E-06	mr1074	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601966608	NA	8.07E-10	mr1141	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601966608	NA	2.51E-07	mr1496	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601966608	NA	9.73E-20	mr1598	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601966608	NA	1.30E-12	mr1609	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601966608	NA	8.37E-06	mr1609	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601966608	NA	4.07E-10	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601966608	NA	4.95E-08	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601966608	NA	3.52E-08	mr1860	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601966608	NA	7.56E-10	mr1141_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601966608	NA	9.88E-06	mr1609_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601966608	NA	2.55E-08	mr1707_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601966608	NA	1.61E-15	mr1728_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601966608	NA	6.80E-11	mr1860_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601966608	NA	4.09E-09	mr1962_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251