\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601966608:

Variant ID: vg0601966608 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 1966608
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, G: 0.02, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


AGATGTTGCTAATTTTTCTTTAAACTTCGTCAACTTAACAAAGTTTGACTAGAAAAAAAATCAAAACAACTTATATGAAACGGAGGAGTAGTAGAAAAAA[C/G]
GGTTTTCACAAGCACCCCCTAATTGCACAGGCGGCATAGTGCCACTGCCTGTGCAGTACATCTAAAGAGTAGTGGGTGTGTCATTGCGTGAAAGATCGGT

Reverse complement sequence

ACCGATCTTTCACGCAATGACACACCCACTACTCTTTAGATGTACTGCACAGGCAGTGGCACTATGCCGCCTGTGCAATTAGGGGGTGCTTGTGAAAACC[G/C]
TTTTTTCTACTACTCCTCCGTTTCATATAAGTTGTTTTGATTTTTTTTCTAGTCAAACTTTGTTAAGTTGACGAAGTTTAAAGAAAAATTAGCAACATCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.30% 24.40% 0.23% 0.00% NA
All Indica  2759 58.50% 41.20% 0.33% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 13.90% 85.50% 0.50% 0.00% NA
Indica II  465 74.40% 25.40% 0.22% 0.00% NA
Indica III  913 79.00% 20.80% 0.22% 0.00% NA
Indica Intermediate  786 58.90% 40.70% 0.38% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 83.30% 14.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0601966608 C -> G LOC_Os06g04540.1 upstream_gene_variant ; 3028.0bp to feature; MODIFIER silent_mutation Average:32.891; most accessible tissue: Zhenshan97 root, score: 54.262 N N N N
vg0601966608 C -> G LOC_Os06g04550.1 upstream_gene_variant ; 2017.0bp to feature; MODIFIER silent_mutation Average:32.891; most accessible tissue: Zhenshan97 root, score: 54.262 N N N N
vg0601966608 C -> G LOC_Os06g04540-LOC_Os06g04550 intergenic_region ; MODIFIER silent_mutation Average:32.891; most accessible tissue: Zhenshan97 root, score: 54.262 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0601966608 NA 8.93E-14 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0601966608 NA 5.36E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601966608 NA 8.07E-10 mr1141 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601966608 NA 2.51E-07 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601966608 NA 9.73E-20 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601966608 NA 1.30E-12 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601966608 NA 8.37E-06 mr1609 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601966608 NA 4.07E-10 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601966608 NA 4.95E-08 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601966608 NA 3.52E-08 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601966608 NA 7.56E-10 mr1141_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601966608 NA 9.88E-06 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601966608 NA 2.55E-08 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601966608 NA 1.61E-15 mr1728_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601966608 NA 6.80E-11 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601966608 NA 4.09E-09 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251