\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601963912:

Variant ID: vg0601963912 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 1963912
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


GGCCGTGTTGTGTTGACCGTGTTCTTATAGCCTTTGCACCTCCACCATTGCCACCACGGCCACGTCACTATGGCTACTAGTATAACGTTGTCAAGACACT[A/G]
CCAAAGTATGGATCTTGGGGAGAATCAGAGATAGGGTGTGGGTGGTACGTACTCACGCCGCGATGCCAAACGGAGCGTCAAATAAGTGACTATACATGTG

Reverse complement sequence

CACATGTATAGTCACTTATTTGACGCTCCGTTTGGCATCGCGGCGTGAGTACGTACCACCCACACCCTATCTCTGATTCTCCCCAAGATCCATACTTTGG[T/C]
AGTGTCTTGACAACGTTATACTAGTAGCCATAGTGACGTGGCCGTGGTGGCAATGGTGGAGGTGCAAAGGCTATAAGAACACGGTCAACACAACACGGCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.80% 40.90% 0.28% 0.00% NA
All Indica  2759 79.80% 19.80% 0.33% 0.00% NA
All Japonica  1512 12.00% 87.70% 0.26% 0.00% NA
Aus  269 96.30% 3.70% 0.00% 0.00% NA
Indica I  595 98.80% 0.80% 0.34% 0.00% NA
Indica II  465 51.40% 48.20% 0.43% 0.00% NA
Indica III  913 81.70% 18.20% 0.11% 0.00% NA
Indica Intermediate  786 80.20% 19.30% 0.51% 0.00% NA
Temperate Japonica  767 19.40% 80.10% 0.52% 0.00% NA
Tropical Japonica  504 3.60% 96.40% 0.00% 0.00% NA
Japonica Intermediate  241 6.20% 93.80% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 46.70% 53.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0601963912 A -> G LOC_Os06g04540.1 upstream_gene_variant ; 332.0bp to feature; MODIFIER silent_mutation Average:98.182; most accessible tissue: Zhenshan97 root, score: 99.594 N N N N
vg0601963912 A -> G LOC_Os06g04550.1 upstream_gene_variant ; 4713.0bp to feature; MODIFIER silent_mutation Average:98.182; most accessible tissue: Zhenshan97 root, score: 99.594 N N N N
vg0601963912 A -> G LOC_Os06g04540-LOC_Os06g04550 intergenic_region ; MODIFIER silent_mutation Average:98.182; most accessible tissue: Zhenshan97 root, score: 99.594 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0601963912 A G -0.01 -0.02 -0.02 0.01 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0601963912 1.91E-10 NA Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0601963912 2.89E-07 1.00E-19 Awn_length Jap_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0601963912 NA 1.81E-09 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601963912 NA 3.87E-16 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601963912 6.57E-13 1.01E-71 mr1141 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601963912 2.34E-13 3.84E-35 mr1141 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601963912 NA 1.19E-17 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601963912 NA 4.74E-17 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601963912 NA 1.51E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601963912 NA 2.95E-12 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601963912 NA 7.37E-09 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601963912 NA 9.45E-13 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601963912 NA 8.40E-16 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601963912 NA 5.53E-06 mr1608 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601963912 NA 3.12E-09 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601963912 NA 5.87E-16 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601963912 NA 8.70E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601963912 NA 5.15E-06 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601963912 NA 4.12E-06 mr1929 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601963912 NA 2.14E-15 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601963912 NA 1.90E-16 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601963912 NA 4.90E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601963912 NA 3.03E-18 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601963912 7.50E-07 5.75E-65 mr1141_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601963912 9.29E-11 3.41E-32 mr1141_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601963912 NA 5.75E-19 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601963912 NA 5.43E-10 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601963912 NA 1.53E-07 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601963912 NA 6.55E-08 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601963912 NA 1.32E-06 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601963912 NA 7.79E-16 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601963912 NA 2.57E-07 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601963912 NA 1.27E-14 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251