\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601857849:

Variant ID: vg0601857849 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 1857849
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGCATGTCACATACCTGATACATTTTTCTTAGCCTCTGCTCCTCTGCATCCTCATCCTGTCAATCCAAGGGCAGAAAAATGTGTCACTAACATTGTAAT[A/G]
ATGAATCTTAATATATGCATGAATGTCTTACAAAAACTAAATGGGGGAAAAGATAGATCATCAGACCTCTTCAGAGTCACTCGACACTATAGTGTCATAT

Reverse complement sequence

ATATGACACTATAGTGTCGAGTGACTCTGAAGAGGTCTGATGATCTATCTTTTCCCCCATTTAGTTTTTGTAAGACATTCATGCATATATTAAGATTCAT[T/C]
ATTACAATGTTAGTGACACATTTTTCTGCCCTTGGATTGACAGGATGAGGATGCAGAGGAGCAGAGGCTAAGAAAAATGTATCAGGTATGTGACATGCTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.30% 45.70% 0.06% 0.91% NA
All Indica  2759 28.40% 70.80% 0.07% 0.72% NA
All Japonica  1512 99.40% 0.40% 0.07% 0.13% NA
Aus  269 30.90% 62.50% 0.00% 6.69% NA
Indica I  595 4.90% 93.90% 0.00% 1.18% NA
Indica II  465 58.90% 40.20% 0.22% 0.65% NA
Indica III  913 27.90% 71.70% 0.00% 0.33% NA
Indica Intermediate  786 28.80% 70.20% 0.13% 0.89% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 0.80% 0.00% 0.40% NA
Japonica Intermediate  241 99.20% 0.40% 0.41% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 67.80% 28.90% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0601857849 A -> G LOC_Os06g04350.1 upstream_gene_variant ; 3951.0bp to feature; MODIFIER silent_mutation Average:47.296; most accessible tissue: Zhenshan97 root, score: 61.518 N N N N
vg0601857849 A -> G LOC_Os06g04360.1 intron_variant ; MODIFIER silent_mutation Average:47.296; most accessible tissue: Zhenshan97 root, score: 61.518 N N N N
vg0601857849 A -> DEL N N silent_mutation Average:47.296; most accessible tissue: Zhenshan97 root, score: 61.518 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0601857849 NA 1.55E-14 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601857849 NA 6.15E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601857849 NA 8.00E-07 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601857849 5.35E-06 6.39E-57 mr1141 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601857849 NA 1.26E-20 mr1141 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601857849 NA 2.69E-14 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601857849 NA 1.91E-16 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601857849 NA 1.16E-06 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601857849 3.72E-06 2.22E-07 mr1955 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601857849 1.07E-07 1.07E-07 mr1955 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601857849 NA 4.66E-07 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601857849 NA 3.06E-09 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601857849 NA 1.41E-66 mr1141_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601857849 7.53E-06 9.12E-20 mr1141_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601857849 NA 1.21E-27 mr1149_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601857849 NA 1.22E-07 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601857849 NA 1.75E-06 mr1402_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601857849 NA 5.40E-28 mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601857849 NA 5.53E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601857849 NA 1.34E-16 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601857849 NA 1.83E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601857849 NA 1.06E-12 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601857849 NA 5.76E-11 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251