\
| Variant ID: vg0601801709 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 1801709 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGTTTCTTAGGCTAGAGCAGTACAACCATGACAGAATGATTGATAGTCCAGTAGTGAGATAAATAGTTAATTAGCAAGATCACCACACTTTGGAGCACAA[C/T]
ACAATGACAAGCACCTGCAAGATTGTTACATTGACCTTCAAAATTTCTTGTGTTGCAGGACGAGTTGATCTTGGCAACCTTGATCAGGTGGATGCAGTAA
TTACTGCATCCACCTGATCAAGGTTGCCAAGATCAACTCGTCCTGCAACACAAGAAATTTTGAAGGTCAATGTAACAATCTTGCAGGTGCTTGTCATTGT[G/A]
TTGTGCTCCAAAGTGTGGTGATCTTGCTAATTAACTATTTATCTCACTACTGGACTATCAATCATTCTGTCATGGTTGTACTGCTCTAGCCTAAGAAACA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.40% | 6.50% | 1.12% | 0.00% | NA |
| All Indica | 2759 | 97.30% | 2.50% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 82.00% | 15.20% | 2.78% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 94.40% | 4.70% | 0.86% | 0.00% | NA |
| Indica III | 913 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.20% | 4.60% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 97.50% | 0.00% | 2.48% | 0.00% | NA |
| Tropical Japonica | 504 | 52.40% | 44.20% | 3.37% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.60% | 2.90% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 7.80% | 5.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0601801709 | C -> T | LOC_Os06g04250-LOC_Os06g04270 | intergenic_region ; MODIFIER | silent_mutation | Average:62.088; most accessible tissue: Callus, score: 77.307 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0601801709 | NA | 2.57E-06 | mr1047 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601801709 | NA | 1.91E-08 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601801709 | NA | 1.94E-06 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601801709 | 2.06E-07 | 8.41E-11 | mr1471 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601801709 | 3.70E-06 | 4.17E-09 | mr1642 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601801709 | 1.18E-06 | 1.18E-06 | mr1815 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601801709 | NA | 2.05E-06 | mr1990 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601801709 | 5.38E-07 | NA | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601801709 | 2.30E-06 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |