\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601801709:

Variant ID: vg0601801709 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 1801709
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTTTCTTAGGCTAGAGCAGTACAACCATGACAGAATGATTGATAGTCCAGTAGTGAGATAAATAGTTAATTAGCAAGATCACCACACTTTGGAGCACAA[C/T]
ACAATGACAAGCACCTGCAAGATTGTTACATTGACCTTCAAAATTTCTTGTGTTGCAGGACGAGTTGATCTTGGCAACCTTGATCAGGTGGATGCAGTAA

Reverse complement sequence

TTACTGCATCCACCTGATCAAGGTTGCCAAGATCAACTCGTCCTGCAACACAAGAAATTTTGAAGGTCAATGTAACAATCTTGCAGGTGCTTGTCATTGT[G/A]
TTGTGCTCCAAAGTGTGGTGATCTTGCTAATTAACTATTTATCTCACTACTGGACTATCAATCATTCTGTCATGGTTGTACTGCTCTAGCCTAAGAAACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.40% 6.50% 1.12% 0.00% NA
All Indica  2759 97.30% 2.50% 0.22% 0.00% NA
All Japonica  1512 82.00% 15.20% 2.78% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 94.40% 4.70% 0.86% 0.00% NA
Indica III  913 98.80% 1.20% 0.00% 0.00% NA
Indica Intermediate  786 95.20% 4.60% 0.25% 0.00% NA
Temperate Japonica  767 97.50% 0.00% 2.48% 0.00% NA
Tropical Japonica  504 52.40% 44.20% 3.37% 0.00% NA
Japonica Intermediate  241 94.60% 2.90% 2.49% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 7.80% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0601801709 C -> T LOC_Os06g04250-LOC_Os06g04270 intergenic_region ; MODIFIER silent_mutation Average:62.088; most accessible tissue: Callus, score: 77.307 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0601801709 NA 2.57E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601801709 NA 1.91E-08 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601801709 NA 1.94E-06 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601801709 2.06E-07 8.41E-11 mr1471 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601801709 3.70E-06 4.17E-09 mr1642 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601801709 1.18E-06 1.18E-06 mr1815 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601801709 NA 2.05E-06 mr1990 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601801709 5.38E-07 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601801709 2.30E-06 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251