\
| Variant ID: vg0601659985 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 1659985 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AATACAGAGAGAATTGCAAACGTAACGAGAACATGAAAGGTGTCAAGGAGTAATCCCTGGCTCGCCTTGATCTGCACTTCTCCTCACTCACTCAATGCGG[C/T]
CATCCCGTTGCAGAGGAGCTCCATCTATAGGGGAAGATCACGTGGTTTGTGATGCTGAATTACGGATCTCTAGGGGGTTCGGAGTCTAATTCTCCAACTT
AAGTTGGAGAATTAGACTCCGAACCCCCTAGAGATCCGTAATTCAGCATCACAAACCACGTGATCTTCCCCTATAGATGGAGCTCCTCTGCAACGGGATG[G/A]
CCGCATTGAGTGAGTGAGGAGAAGTGCAGATCAAGGCGAGCCAGGGATTACTCCTTGACACCTTTCATGTTCTCGTTACGTTTGCAATTCTCTCTGTATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 86.60% | 13.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 67.10% | 32.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.50% | 14.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 52.10% | 47.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 20.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0601659985 | C -> T | LOC_Os06g04040-LOC_Os06g04060 | intergenic_region ; MODIFIER | silent_mutation | Average:56.19; most accessible tissue: Callus, score: 82.498 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0601659985 | NA | 7.51E-06 | mr1852 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601659985 | 8.86E-07 | NA | mr1040_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601659985 | NA | 3.58E-07 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601659985 | NA | 6.16E-06 | mr1195_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601659985 | NA | 3.14E-09 | mr1304_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601659985 | 4.96E-06 | NA | mr1362_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601659985 | NA | 1.61E-07 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601659985 | NA | 1.83E-06 | mr1707_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601659985 | 6.04E-08 | NA | mr1846_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601659985 | 4.61E-07 | 4.61E-07 | mr1846_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601659985 | NA | 5.11E-06 | mr1852_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |