Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601656131:

Variant ID: vg0601656131 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 1656131
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

CCAGTCTGTTCAAACCGGGTTTAAAAAAACACGTGGTTTTTTTTATCATGCACACATAAATTAAAGCAGAACTACTATTTTTGAATAAAATATGTTACGT[C/T]
TGGATCTCATCGGGATGGTCTAGACCAGGTTAACAACCAAAAACACGGAGTTTTCAGTGGTGCACACGTAAATTAAAGAACTATTATTTTAGGATAAAAT

Reverse complement sequence

ATTTTATCCTAAAATAATAGTTCTTTAATTTACGTGTGCACCACTGAAAACTCCGTGTTTTTGGTTGTTAACCTGGTCTAGACCATCCCGATGAGATCCA[G/A]
ACGTAACATATTTTATTCAAAAATAGTAGTTCTGCTTTAATTTATGTGTGCATGATAAAAAAAACCACGTGTTTTTTTAAACCCGGTTTGAACAGACTGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.00%	5.00%	0.02%	0.00%	NA
All Indica	2759	95.80%	4.10%	0.04%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	58.70%	41.30%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	90.80%	9.20%	0.00%	0.00%	NA
Indica III	913	96.30%	3.60%	0.11%	0.00%	NA
Indica Intermediate	786	95.20%	4.80%	0.00%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0601656131	C -> T	LOC_Os06g04040.1	downstream_gene_variant ; 1831.0bp to feature; MODIFIER	silent_mutation	Average:40.784; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0601656131	C -> T	LOC_Os06g04040.3	downstream_gene_variant ; 4625.0bp to feature; MODIFIER	silent_mutation	Average:40.784; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0601656131	C -> T	LOC_Os06g04040.2	downstream_gene_variant ; 1831.0bp to feature; MODIFIER	silent_mutation	Average:40.784; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0601656131	C -> T	LOC_Os06g04040-LOC_Os06g04060	intergenic_region ; MODIFIER	silent_mutation	Average:40.784; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0601656131	NA	5.34E-09	mr1310	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601656131	NA	1.97E-10	mr1498	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601656131	NA	1.08E-06	mr1925	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601656131	9.46E-06	NA	mr1256_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601656131	NA	1.78E-08	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601656131	NA	9.72E-07	mr1322_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601656131	NA	8.53E-06	mr1332_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601656131	NA	1.07E-06	mr1449_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601656131	NA	6.28E-08	mr1498_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601656131	NA	1.28E-08	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601656131	1.34E-06	NA	mr1795_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601656131	NA	7.90E-07	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251