\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601656131:

Variant ID: vg0601656131 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 1656131
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


CCAGTCTGTTCAAACCGGGTTTAAAAAAACACGTGGTTTTTTTTATCATGCACACATAAATTAAAGCAGAACTACTATTTTTGAATAAAATATGTTACGT[C/T]
TGGATCTCATCGGGATGGTCTAGACCAGGTTAACAACCAAAAACACGGAGTTTTCAGTGGTGCACACGTAAATTAAAGAACTATTATTTTAGGATAAAAT

Reverse complement sequence

ATTTTATCCTAAAATAATAGTTCTTTAATTTACGTGTGCACCACTGAAAACTCCGTGTTTTTGGTTGTTAACCTGGTCTAGACCATCCCGATGAGATCCA[G/A]
ACGTAACATATTTTATTCAAAAATAGTAGTTCTGCTTTAATTTATGTGTGCATGATAAAAAAAACCACGTGTTTTTTTAAACCCGGTTTGAACAGACTGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.00% 5.00% 0.02% 0.00% NA
All Indica  2759 95.80% 4.10% 0.04% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 58.70% 41.30% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 90.80% 9.20% 0.00% 0.00% NA
Indica III  913 96.30% 3.60% 0.11% 0.00% NA
Indica Intermediate  786 95.20% 4.80% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0601656131 C -> T LOC_Os06g04040.1 downstream_gene_variant ; 1831.0bp to feature; MODIFIER silent_mutation Average:40.784; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0601656131 C -> T LOC_Os06g04040.3 downstream_gene_variant ; 4625.0bp to feature; MODIFIER silent_mutation Average:40.784; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0601656131 C -> T LOC_Os06g04040.2 downstream_gene_variant ; 1831.0bp to feature; MODIFIER silent_mutation Average:40.784; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0601656131 C -> T LOC_Os06g04040-LOC_Os06g04060 intergenic_region ; MODIFIER silent_mutation Average:40.784; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0601656131 NA 5.34E-09 mr1310 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601656131 NA 1.97E-10 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601656131 NA 1.08E-06 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601656131 9.46E-06 NA mr1256_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601656131 NA 1.78E-08 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601656131 NA 9.72E-07 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601656131 NA 8.53E-06 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601656131 NA 1.07E-06 mr1449_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601656131 NA 6.28E-08 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601656131 NA 1.28E-08 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601656131 1.34E-06 NA mr1795_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601656131 NA 7.90E-07 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251