\
| Variant ID: vg0601656131 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 1656131 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 213. )
CCAGTCTGTTCAAACCGGGTTTAAAAAAACACGTGGTTTTTTTTATCATGCACACATAAATTAAAGCAGAACTACTATTTTTGAATAAAATATGTTACGT[C/T]
TGGATCTCATCGGGATGGTCTAGACCAGGTTAACAACCAAAAACACGGAGTTTTCAGTGGTGCACACGTAAATTAAAGAACTATTATTTTAGGATAAAAT
ATTTTATCCTAAAATAATAGTTCTTTAATTTACGTGTGCACCACTGAAAACTCCGTGTTTTTGGTTGTTAACCTGGTCTAGACCATCCCGATGAGATCCA[G/A]
ACGTAACATATTTTATTCAAAAATAGTAGTTCTGCTTTAATTTATGTGTGCATGATAAAAAAAACCACGTGTTTTTTTAAACCCGGTTTGAACAGACTGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.00% | 5.00% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 95.80% | 4.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 58.70% | 41.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 90.80% | 9.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.30% | 3.60% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0601656131 | C -> T | LOC_Os06g04040.1 | downstream_gene_variant ; 1831.0bp to feature; MODIFIER | silent_mutation | Average:40.784; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0601656131 | C -> T | LOC_Os06g04040.3 | downstream_gene_variant ; 4625.0bp to feature; MODIFIER | silent_mutation | Average:40.784; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0601656131 | C -> T | LOC_Os06g04040.2 | downstream_gene_variant ; 1831.0bp to feature; MODIFIER | silent_mutation | Average:40.784; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0601656131 | C -> T | LOC_Os06g04040-LOC_Os06g04060 | intergenic_region ; MODIFIER | silent_mutation | Average:40.784; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0601656131 | NA | 5.34E-09 | mr1310 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601656131 | NA | 1.97E-10 | mr1498 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601656131 | NA | 1.08E-06 | mr1925 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601656131 | 9.46E-06 | NA | mr1256_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601656131 | NA | 1.78E-08 | mr1310_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601656131 | NA | 9.72E-07 | mr1322_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601656131 | NA | 8.53E-06 | mr1332_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601656131 | NA | 1.07E-06 | mr1449_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601656131 | NA | 6.28E-08 | mr1498_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601656131 | NA | 1.28E-08 | mr1769_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601656131 | 1.34E-06 | NA | mr1795_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601656131 | NA | 7.90E-07 | mr1951_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |