\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601643650:

Variant ID: vg0601643650 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 1643650
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTTCTCCTTCTCCTTCTCACCCTCCGCCTTCTTCTCCTCCCCCTCCTCAGCCTTCGGCGCCTCCTCCGGCTTCGGTGCCTCCAAAGCCTCCTTCGCCTC[C/A]
TCTACCACCGCTGGCGGCGGCGGCGGCGGCGCCTCGCCGGCGGCAGCAGCCGCAGCGGCAACCTCCTCGGTCGCAGTCGCCATGGGAGAATACCAGAGTG

Reverse complement sequence

CACTCTGGTATTCTCCCATGGCGACTGCGACCGAGGAGGTTGCCGCTGCGGCTGCTGCCGCCGGCGAGGCGCCGCCGCCGCCGCCGCCAGCGGTGGTAGA[G/T]
GAGGCGAAGGAGGCTTTGGAGGCACCGAAGCCGGAGGAGGCGCCGAAGGCTGAGGAGGGGGAGGAGAAGAAGGCGGAGGGTGAGAAGGAGAAGGAGAAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.90% 9.10% 0.00% 0.00% NA
All Indica  2759 85.10% 14.90% 0.00% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 82.20% 17.80% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 76.10% 23.90% 0.00% 0.00% NA
Indica Intermediate  786 88.80% 11.20% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0601643650 C -> A LOC_Os06g04020.1 missense_variant ; p.Glu28Asp; MODERATE nonsynonymous_codon ; E28D Average:96.438; most accessible tissue: Minghui63 panicle, score: 98.805 unknown unknown TOLERATED 0.23

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0601643650 C A -0.01 -0.01 -0.01 -0.02 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0601643650 3.66E-06 1.27E-09 mr1336 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601643650 NA 1.67E-07 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601643650 NA 8.29E-06 mr1438_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601643650 NA 9.21E-06 mr1579_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251