\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601639995:

Variant ID: vg0601639995 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 1639995
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 359. )

Flanking Sequence (100 bp) in Reference Genome:


AGAAAATGTATGGAGCTTGAGCCAGCACGGCATAGAGAAGAGCATCCACACTAAACTGACTTTTTAGATAATCGACAAACCAGCCGTTACATCTAAGATG[C/G]
ACGAAGTCACAAACAATTAGTGCAATAGTTCCACGCCATTTTGGAAAGATAAATACGCAACAAGTTCAACAATCATTAAAGAGGAACACAAAATTTCAAC

Reverse complement sequence

GTTGAAATTTTGTGTTCCTCTTTAATGATTGTTGAACTTGTTGCGTATTTATCTTTCCAAAATGGCGTGGAACTATTGCACTAATTGTTTGTGACTTCGT[G/C]
CATCTTAGATGTAACGGCTGGTTTGTCGATTATCTAAAAAGTCAGTTTAGTGTGGATGCTCTTCTCTATGCCGTGCTGGCTCAAGCTCCATACATTTTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.30% 6.70% 0.00% 0.00% NA
All Indica  2759 98.30% 1.70% 0.00% 0.00% NA
All Japonica  1512 86.60% 13.40% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 94.00% 6.00% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 98.00% 2.00% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 67.30% 32.70% 0.00% 0.00% NA
Japonica Intermediate  241 85.50% 14.50% 0.00% 0.00% NA
VI/Aromatic  96 52.10% 47.90% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0601639995 C -> G LOC_Os06g04000.1 downstream_gene_variant ; 3966.0bp to feature; MODIFIER silent_mutation Average:72.013; most accessible tissue: Minghui63 flag leaf, score: 87.854 N N N N
vg0601639995 C -> G LOC_Os06g04020.1 downstream_gene_variant ; 2219.0bp to feature; MODIFIER silent_mutation Average:72.013; most accessible tissue: Minghui63 flag leaf, score: 87.854 N N N N
vg0601639995 C -> G LOC_Os06g04010.1 intron_variant ; MODIFIER silent_mutation Average:72.013; most accessible tissue: Minghui63 flag leaf, score: 87.854 N N N N
vg0601639995 C -> G LOC_Os06g04010.2 intron_variant ; MODIFIER silent_mutation Average:72.013; most accessible tissue: Minghui63 flag leaf, score: 87.854 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0601639995 3.70E-07 NA mr1040_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601639995 NA 7.07E-08 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601639995 NA 1.89E-06 mr1195_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601639995 4.92E-06 NA mr1208_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601639995 2.30E-06 7.41E-09 mr1304_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601639995 NA 5.80E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601639995 2.41E-06 4.80E-07 mr1707_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601639995 4.13E-06 NA mr1728_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601639995 7.62E-08 NA mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601639995 1.34E-06 1.34E-06 mr1846_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601639995 NA 2.90E-06 mr1852_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251