Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601639995:

Variant ID: vg0601639995 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 1639995
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 359. )

Flanking Sequence (100 bp) in Reference Genome:

AGAAAATGTATGGAGCTTGAGCCAGCACGGCATAGAGAAGAGCATCCACACTAAACTGACTTTTTAGATAATCGACAAACCAGCCGTTACATCTAAGATG[C/G]
ACGAAGTCACAAACAATTAGTGCAATAGTTCCACGCCATTTTGGAAAGATAAATACGCAACAAGTTCAACAATCATTAAAGAGGAACACAAAATTTCAAC

Reverse complement sequence

GTTGAAATTTTGTGTTCCTCTTTAATGATTGTTGAACTTGTTGCGTATTTATCTTTCCAAAATGGCGTGGAACTATTGCACTAATTGTTTGTGACTTCGT[G/C]
CATCTTAGATGTAACGGCTGGTTTGTCGATTATCTAAAAAGTCAGTTTAGTGTGGATGCTCTTCTCTATGCCGTGCTGGCTCAAGCTCCATACATTTTCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.30%	6.70%	0.00%	0.00%	NA
All Indica	2759	98.30%	1.70%	0.00%	0.00%	NA
All Japonica	1512	86.60%	13.40%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	94.00%	6.00%	0.00%	0.00%	NA
Indica III	913	99.60%	0.40%	0.00%	0.00%	NA
Indica Intermediate	786	98.00%	2.00%	0.00%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	67.30%	32.70%	0.00%	0.00%	NA
Japonica Intermediate	241	85.50%	14.50%	0.00%	0.00%	NA
VI/Aromatic	96	52.10%	47.90%	0.00%	0.00%	NA
Intermediate	90	80.00%	20.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0601639995	C -> G	LOC_Os06g04000.1	downstream_gene_variant ; 3966.0bp to feature; MODIFIER	silent_mutation	Average:72.013; most accessible tissue: Minghui63 flag leaf, score: 87.854	N	N	N	N
vg0601639995	C -> G	LOC_Os06g04020.1	downstream_gene_variant ; 2219.0bp to feature; MODIFIER	silent_mutation	Average:72.013; most accessible tissue: Minghui63 flag leaf, score: 87.854	N	N	N	N
vg0601639995	C -> G	LOC_Os06g04010.1	intron_variant ; MODIFIER	silent_mutation	Average:72.013; most accessible tissue: Minghui63 flag leaf, score: 87.854	N	N	N	N
vg0601639995	C -> G	LOC_Os06g04010.2	intron_variant ; MODIFIER	silent_mutation	Average:72.013; most accessible tissue: Minghui63 flag leaf, score: 87.854	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0601639995	3.70E-07	NA	mr1040_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601639995	NA	7.07E-08	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601639995	NA	1.89E-06	mr1195_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601639995	4.92E-06	NA	mr1208_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601639995	2.30E-06	7.41E-09	mr1304_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601639995	NA	5.80E-07	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601639995	2.41E-06	4.80E-07	mr1707_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601639995	4.13E-06	NA	mr1728_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601639995	7.62E-08	NA	mr1846_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601639995	1.34E-06	1.34E-06	mr1846_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601639995	NA	2.90E-06	mr1852_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251