Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0601625010:

Variant ID: vg0601625010 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 1625010
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.03, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTGTCCATTTCGGTAGAGTTTTGGAAAATTCTACGAGTCACATAATTTGTCTGTTTGAGTTTATTTTTTATATGGTTGGTTCCTATGTTCTCCTAAGT[A/G]
TGAAAAAAATATCAAAAAAATGAAATAAAAATAAAAAAATTGCATCTCTCTATACTGGTTAACTTATGGCTATTATTTCATGTGGTTATATTTTGAATTA

Reverse complement sequence

TAATTCAAAATATAACCACATGAAATAATAGCCATAAGTTAACCAGTATAGAGAGATGCAATTTTTTTATTTTTATTTCATTTTTTTGATATTTTTTTCA[T/C]
ACTTAGGAGAACATAGGAACCAACCATATAAAAAATAAACTCAAACAGACAAATTATGTGACTCGTAGAATTTTCCAAAACTCTACCGAAATGGACAAAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.80%	43.30%	11.91%	0.00%	NA
All Indica	2759	27.90%	56.00%	16.09%	0.00%	NA
All Japonica	1512	83.70%	11.60%	4.70%	0.00%	NA
Aus	269	4.10%	88.50%	7.43%	0.00%	NA
Indica I	595	11.80%	67.60%	20.67%	0.00%	NA
Indica II	465	50.50%	36.10%	13.33%	0.00%	NA
Indica III	913	30.00%	56.80%	13.14%	0.00%	NA
Indica Intermediate	786	24.40%	57.90%	17.68%	0.00%	NA
Temperate Japonica	767	99.50%	0.40%	0.13%	0.00%	NA
Tropical Japonica	504	58.70%	28.00%	13.29%	0.00%	NA
Japonica Intermediate	241	85.50%	13.30%	1.24%	0.00%	NA
VI/Aromatic	96	29.20%	59.40%	11.46%	0.00%	NA
Intermediate	90	47.80%	33.30%	18.89%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0601625010	A -> G	LOC_Os06g03980.1	upstream_gene_variant ; 4827.0bp to feature; MODIFIER	silent_mutation	Average:32.189; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0601625010	A -> G	LOC_Os06g03990.1	upstream_gene_variant ; 4707.0bp to feature; MODIFIER	silent_mutation	Average:32.189; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0601625010	A -> G	LOC_Os06g03980-LOC_Os06g03990	intergenic_region ; MODIFIER	silent_mutation	Average:32.189; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0601625010	NA	4.49E-14	Grain_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0601625010	NA	1.82E-18	mr1059	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601625010	NA	6.81E-19	mr1143	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601625010	NA	5.59E-19	mr1167	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601625010	NA	1.64E-11	mr1182	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601625010	NA	9.55E-13	mr1399	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601625010	NA	8.61E-07	mr1399	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601625010	NA	2.44E-18	mr1535	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601625010	NA	9.43E-09	mr1658	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601625010	NA	3.25E-18	mr1675	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601625010	NA	3.79E-08	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601625010	4.31E-06	1.11E-20	mr1726	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601625010	NA	6.21E-08	mr1726	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601625010	NA	2.95E-16	mr1950	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601625010	NA	1.82E-18	mr1969	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601625010	NA	4.70E-20	mr1995	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601625010	NA	1.06E-07	mr1399_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601625010	NA	7.01E-07	mr1805_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251