\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601625010:

Variant ID: vg0601625010 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 1625010
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.03, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTGTCCATTTCGGTAGAGTTTTGGAAAATTCTACGAGTCACATAATTTGTCTGTTTGAGTTTATTTTTTATATGGTTGGTTCCTATGTTCTCCTAAGT[A/G]
TGAAAAAAATATCAAAAAAATGAAATAAAAATAAAAAAATTGCATCTCTCTATACTGGTTAACTTATGGCTATTATTTCATGTGGTTATATTTTGAATTA

Reverse complement sequence

TAATTCAAAATATAACCACATGAAATAATAGCCATAAGTTAACCAGTATAGAGAGATGCAATTTTTTTATTTTTATTTCATTTTTTTGATATTTTTTTCA[T/C]
ACTTAGGAGAACATAGGAACCAACCATATAAAAAATAAACTCAAACAGACAAATTATGTGACTCGTAGAATTTTCCAAAACTCTACCGAAATGGACAAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.80% 43.30% 11.91% 0.00% NA
All Indica  2759 27.90% 56.00% 16.09% 0.00% NA
All Japonica  1512 83.70% 11.60% 4.70% 0.00% NA
Aus  269 4.10% 88.50% 7.43% 0.00% NA
Indica I  595 11.80% 67.60% 20.67% 0.00% NA
Indica II  465 50.50% 36.10% 13.33% 0.00% NA
Indica III  913 30.00% 56.80% 13.14% 0.00% NA
Indica Intermediate  786 24.40% 57.90% 17.68% 0.00% NA
Temperate Japonica  767 99.50% 0.40% 0.13% 0.00% NA
Tropical Japonica  504 58.70% 28.00% 13.29% 0.00% NA
Japonica Intermediate  241 85.50% 13.30% 1.24% 0.00% NA
VI/Aromatic  96 29.20% 59.40% 11.46% 0.00% NA
Intermediate  90 47.80% 33.30% 18.89% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0601625010 A -> G LOC_Os06g03980.1 upstream_gene_variant ; 4827.0bp to feature; MODIFIER silent_mutation Average:32.189; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0601625010 A -> G LOC_Os06g03990.1 upstream_gene_variant ; 4707.0bp to feature; MODIFIER silent_mutation Average:32.189; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0601625010 A -> G LOC_Os06g03980-LOC_Os06g03990 intergenic_region ; MODIFIER silent_mutation Average:32.189; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0601625010 NA 4.49E-14 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0601625010 NA 1.82E-18 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601625010 NA 6.81E-19 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601625010 NA 5.59E-19 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601625010 NA 1.64E-11 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601625010 NA 9.55E-13 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601625010 NA 8.61E-07 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601625010 NA 2.44E-18 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601625010 NA 9.43E-09 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601625010 NA 3.25E-18 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601625010 NA 3.79E-08 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601625010 4.31E-06 1.11E-20 mr1726 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601625010 NA 6.21E-08 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601625010 NA 2.95E-16 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601625010 NA 1.82E-18 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601625010 NA 4.70E-20 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601625010 NA 1.06E-07 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601625010 NA 7.01E-07 mr1805_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251