\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601621892:

Variant ID: vg0601621892 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 1621892
Reference Allele: GAlternative Allele: A,GT
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATAAAGAACAAATTTCTCACGTTCAGATTCATTGATAACAGATGATACCGTTGACTTTTTTTAACATATTTGACTATTTATCTTATTCAAAAATTTTAT[G/A,GT]
CAAATGTATAAGATATAAATCACACTTAAATTACTATGAGTGATAAAACAACTCATAACAAAATAAATTATAATTACGTAAATTTTTTGAATAAGACGAA

Reverse complement sequence

TTCGTCTTATTCAAAAAATTTACGTAATTATAATTTATTTTGTTATGAGTTGTTTTATCACTCATAGTAATTTAAGTGTGATTTATATCTTATACATTTG[C/T,AC]
ATAAAATTTTTGAATAAGATAAATAGTCAAATATGTTAAAAAAAGTCAACGGTATCATCTGTTATCAATGAATCTGAACGTGAGAAATTTGTTCTTTATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.60% 9.10% 14.24% 18.09% GT: 0.02%
All Indica  2759 45.20% 5.60% 21.78% 27.40% NA
All Japonica  1512 85.80% 13.60% 0.53% 0.13% NA
Aus  269 49.10% 0.40% 18.59% 31.60% GT: 0.37%
Indica I  595 26.20% 4.50% 23.36% 45.88% NA
Indica II  465 61.30% 6.20% 16.13% 16.34% NA
Indica III  913 48.00% 7.10% 24.32% 20.59% NA
Indica Intermediate  786 46.80% 4.30% 20.99% 27.86% NA
Temperate Japonica  767 98.80% 0.40% 0.78% 0.00% NA
Tropical Japonica  504 65.90% 33.30% 0.40% 0.40% NA
Japonica Intermediate  241 85.90% 14.10% 0.00% 0.00% NA
VI/Aromatic  96 40.60% 47.90% 8.33% 3.12% NA
Intermediate  90 60.00% 23.30% 6.67% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0601621892 G -> A LOC_Os06g03980.1 upstream_gene_variant ; 1709.0bp to feature; MODIFIER silent_mutation Average:75.389; most accessible tissue: Minghui63 panicle, score: 95.862 N N N N
vg0601621892 G -> A LOC_Os06g03980-LOC_Os06g03990 intergenic_region ; MODIFIER silent_mutation Average:75.389; most accessible tissue: Minghui63 panicle, score: 95.862 N N N N
vg0601621892 G -> DEL N N silent_mutation Average:75.389; most accessible tissue: Minghui63 panicle, score: 95.862 N N N N
vg0601621892 G -> GT LOC_Os06g03980.1 upstream_gene_variant ; 1710.0bp to feature; MODIFIER silent_mutation Average:75.389; most accessible tissue: Minghui63 panicle, score: 95.862 N N N N
vg0601621892 G -> GT LOC_Os06g03980-LOC_Os06g03990 intergenic_region ; MODIFIER silent_mutation Average:75.389; most accessible tissue: Minghui63 panicle, score: 95.862 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0601621892 G A 0.02 0.01 -0.01 0.0 0.01 0.02
vg0601621892 G GT -0.01 0.02 -0.03 0.01 0.02 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0601621892 1.16E-06 5.60E-07 mr1852 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601621892 2.94E-06 NA mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601621892 2.03E-06 NA mr1070_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601621892 3.67E-06 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601621892 2.80E-07 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601621892 8.11E-06 NA mr1208_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601621892 2.76E-06 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601621892 NA 3.27E-06 mr1227_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601621892 7.63E-06 NA mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601621892 NA 2.14E-06 mr1707_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601621892 2.37E-06 2.37E-06 mr1846_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601621892 NA 8.18E-06 mr1852_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251