\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601598971:

Variant ID: vg0601598971 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 1598971
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTATTCTATAACCTTGGACTAATTCGCGAGACGAATCTTTTGAGTCTAATTACACCATGATTTGACAATGTGATGCTACAGTAAACTTTTCATAATTAT[G/A]
GATTAATTAGGCTTAAAAAATTCGTCTCGCAGATTAGCTTTCATTTATGAAATTAGTTTTTTTATTAGTCTATGTTTAATACTCCAAATTAGCGTCAAAC

Reverse complement sequence

GTTTGACGCTAATTTGGAGTATTAAACATAGACTAATAAAAAAACTAATTTCATAAATGAAAGCTAATCTGCGAGACGAATTTTTTAAGCCTAATTAATC[C/T]
ATAATTATGAAAAGTTTACTGTAGCATCACATTGTCAAATCATGGTGTAATTAGACTCAAAAGATTCGTCTCGCGAATTAGTCCAAGGTTATAGAATAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.80% 1.00% 0.80% 61.38% NA
All Indica  2759 15.70% 1.70% 1.09% 81.44% NA
All Japonica  1512 81.10% 0.00% 0.33% 18.58% NA
Aus  269 4.10% 0.00% 0.00% 95.91% NA
Indica I  595 1.50% 0.00% 1.34% 97.14% NA
Indica II  465 44.30% 7.50% 1.29% 46.88% NA
Indica III  913 9.90% 0.00% 0.77% 89.38% NA
Indica Intermediate  786 16.40% 1.70% 1.15% 80.79% NA
Temperate Japonica  767 99.30% 0.00% 0.13% 0.52% NA
Tropical Japonica  504 52.60% 0.00% 0.79% 46.63% NA
Japonica Intermediate  241 82.60% 0.00% 0.00% 17.43% NA
VI/Aromatic  96 27.10% 0.00% 1.04% 71.88% NA
Intermediate  90 45.60% 1.10% 2.22% 51.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0601598971 G -> A LOC_Os06g03940.1 downstream_gene_variant ; 2812.0bp to feature; MODIFIER silent_mutation Average:63.136; most accessible tissue: Minghui63 panicle, score: 91.756 N N N N
vg0601598971 G -> A LOC_Os06g03960.1 downstream_gene_variant ; 357.0bp to feature; MODIFIER silent_mutation Average:63.136; most accessible tissue: Minghui63 panicle, score: 91.756 N N N N
vg0601598971 G -> A LOC_Os06g03940-LOC_Os06g03960 intergenic_region ; MODIFIER silent_mutation Average:63.136; most accessible tissue: Minghui63 panicle, score: 91.756 N N N N
vg0601598971 G -> DEL N N silent_mutation Average:63.136; most accessible tissue: Minghui63 panicle, score: 91.756 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0601598971 G A 0.01 0.01 0.0 0.0 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0601598971 NA 3.79E-06 mr1310 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601598971 NA 2.71E-08 mr1896 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601598971 NA 1.13E-08 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601598971 NA 8.23E-06 mr1168_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601598971 NA 4.92E-09 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601598971 NA 9.34E-06 mr1720_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601598971 NA 6.67E-07 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601598971 3.56E-06 1.82E-08 mr1907_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601598971 3.99E-07 2.07E-10 mr1934_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251