Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601502296:

Variant ID: vg0601502296 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 1502296
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGGCCTCGGCACGGTCGGCGGCCGCCGGAATATGGGGGCGGCAGCGGCGACCGGCGAGGGGTCGTAGCGTGAGCGTGAGCCGCGGAGGAGGTGGCCCGC[G/C]
GCCAGTATGCGGGAGGTCGGCCTCATGGCGCTCGCCGGCGACGACGATGCAGATGATTGGATGGAAGCCGAAGCGTGGAAGAGGCGGAGTTGGACTTGGA

Reverse complement sequence

TCCAAGTCCAACTCCGCCTCTTCCACGCTTCGGCTTCCATCCAATCATCTGCATCGTCGTCGCCGGCGAGCGCCATGAGGCCGACCTCCCGCATACTGGC[C/G]
GCGGGCCACCTCCTCCGCGGCTCACGCTCACGCTACGACCCCTCGCCGGTCGCCGCTGCCGCCCCCATATTCCGGCGGCCGCCGACCGTGCCGAGGCCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.60% 13.40% 0.02% 0.00% NA
All Indica  2759 97.30% 2.70% 0.00% 0.00% NA
All Japonica  1512 70.00% 30.00% 0.00% 0.00% NA
Aus  269 75.10% 24.50% 0.37% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 96.20% 3.80% 0.00% 0.00% NA
Indica Intermediate  786 96.10% 3.90% 0.00% 0.00% NA
Temperate Japonica  767 78.90% 21.10% 0.00% 0.00% NA
Tropical Japonica  504 56.70% 43.30% 0.00% 0.00% NA
Japonica Intermediate  241 69.30% 30.70% 0.00% 0.00% NA
VI/Aromatic  96 77.10% 22.90% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0601502296 G -> C LOC_Os06g03770.1 synonymous_variant ; p.Ala9Ala; LOW synonymous_codon Average:95.962; most accessible tissue: Minghui63 root, score: 97.323 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0601502296 G C 0.0 0.0 -0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0601502296 NA 1.13E-19 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0601502296 NA 7.01E-09 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0601502296 NA 3.19E-06 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601502296 NA 7.80E-06 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601502296 1.44E-09 NA mr1137_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601502296 8.86E-06 1.55E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601502296 1.74E-07 NA mr1617_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601502296 NA 6.32E-07 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251