\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601498593:

Variant ID: vg0601498593 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 1498593
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.06, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


CTTGTTTCCACACCAATTTTCAGAAGAATCAAAGTGGGATATAGGCTATAACCACCAAAATAGTGCAGCCCTAGACTAGGTTTCTCATCATCTCCCATGC[G/A]
TAAATGCTGAAATATATACATGCAGTCAAGCTACCTAATTTGGCAATTCCTTGCAATTATTTGCTACAACTTGTAAGCCACCTACATTAACTGTGATGCT

Reverse complement sequence

AGCATCACAGTTAATGTAGGTGGCTTACAAGTTGTAGCAAATAATTGCAAGGAATTGCCAAATTAGGTAGCTTGACTGCATGTATATATTTCAGCATTTA[C/T]
GCATGGGAGATGATGAGAAACCTAGTCTAGGGCTGCACTATTTTGGTGGTTATAGCCTATATCCCACTTTGATTCTTCTGAAAATTGGTGTGGAAACAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.60% 37.30% 0.04% 0.00% NA
All Indica  2759 45.50% 54.50% 0.00% 0.00% NA
All Japonica  1512 99.60% 0.30% 0.07% 0.00% NA
Aus  269 27.50% 72.50% 0.00% 0.00% NA
Indica I  595 32.10% 67.90% 0.00% 0.00% NA
Indica II  465 64.70% 35.30% 0.00% 0.00% NA
Indica III  913 41.40% 58.60% 0.00% 0.00% NA
Indica Intermediate  786 48.90% 51.10% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.41% 0.00% NA
VI/Aromatic  96 58.30% 40.60% 1.04% 0.00% NA
Intermediate  90 76.70% 23.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0601498593 G -> A LOC_Os06g03770.1 intron_variant ; MODIFIER silent_mutation Average:43.781; most accessible tissue: Callus, score: 60.048 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0601498593 NA 7.32E-06 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601498593 NA 3.40E-07 mr1380 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601498593 NA 6.06E-09 mr1561 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601498593 NA 4.98E-06 mr1908 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601498593 NA 3.53E-07 mr1937 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601498593 2.51E-06 2.51E-06 mr1996 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601498593 NA 3.55E-09 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601498593 NA 2.32E-09 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601498593 NA 2.23E-06 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601498593 NA 6.61E-07 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601498593 NA 4.81E-06 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601498593 NA 1.26E-06 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251