\
| Variant ID: vg0601498593 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 1498593 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.06, others allele: 0.00, population size: 259. )
CTTGTTTCCACACCAATTTTCAGAAGAATCAAAGTGGGATATAGGCTATAACCACCAAAATAGTGCAGCCCTAGACTAGGTTTCTCATCATCTCCCATGC[G/A]
TAAATGCTGAAATATATACATGCAGTCAAGCTACCTAATTTGGCAATTCCTTGCAATTATTTGCTACAACTTGTAAGCCACCTACATTAACTGTGATGCT
AGCATCACAGTTAATGTAGGTGGCTTACAAGTTGTAGCAAATAATTGCAAGGAATTGCCAAATTAGGTAGCTTGACTGCATGTATATATTTCAGCATTTA[C/T]
GCATGGGAGATGATGAGAAACCTAGTCTAGGGCTGCACTATTTTGGTGGTTATAGCCTATATCCCACTTTGATTCTTCTGAAAATTGGTGTGGAAACAAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.60% | 37.30% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 45.50% | 54.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.60% | 0.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 27.50% | 72.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 32.10% | 67.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 64.70% | 35.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 41.40% | 58.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 48.90% | 51.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 58.30% | 40.60% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 23.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0601498593 | G -> A | LOC_Os06g03770.1 | intron_variant ; MODIFIER | silent_mutation | Average:43.781; most accessible tissue: Callus, score: 60.048 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0601498593 | NA | 7.32E-06 | mr1124 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601498593 | NA | 3.40E-07 | mr1380 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601498593 | NA | 6.06E-09 | mr1561 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601498593 | NA | 4.98E-06 | mr1908 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601498593 | NA | 3.53E-07 | mr1937 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601498593 | 2.51E-06 | 2.51E-06 | mr1996 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601498593 | NA | 3.55E-09 | mr1124_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601498593 | NA | 2.32E-09 | mr1222_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601498593 | NA | 2.23E-06 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601498593 | NA | 6.61E-07 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601498593 | NA | 4.81E-06 | mr1592_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601498593 | NA | 1.26E-06 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |