\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601490087:

Variant ID: vg0601490087 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 1490087
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


TGTAGACGGCGAGCCAGAGGGTCTTCATGGGGAGGGTGAGGGAGCAGGCGCCGCTGTAGATGGCGCGGCGGCAGGCCTGGCGGTTGGCGACGTCGGCGGG[G/A]
AGCATGAGGATGGAGAGGAGGGCGACGGTGATGCCGAGGACGACGACGAGCTTGGGGAAGTAGGCCTGGTTGGCGTCGTCGGGGTGCTGGTAGTTGATGA

Reverse complement sequence

TCATCAACTACCAGCACCCCGACGACGCCAACCAGGCCTACTTCCCCAAGCTCGTCGTCGTCCTCGGCATCACCGTCGCCCTCCTCTCCATCCTCATGCT[C/T]
CCCGCCGACGTCGCCAACCGCCAGGCCTGCCGCCGCGCCATCTACAGCGGCGCCTGCTCCCTCACCCTCCCCATGAAGACCCTCTGGCTCGCCGTCTACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.90% 31.10% 0.02% 0.00% NA
All Indica  2759 52.40% 47.60% 0.00% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 49.10% 50.60% 0.37% 0.00% NA
Indica I  595 31.90% 68.10% 0.00% 0.00% NA
Indica II  465 69.00% 31.00% 0.00% 0.00% NA
Indica III  913 55.40% 44.60% 0.00% 0.00% NA
Indica Intermediate  786 54.60% 45.40% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0601490087 G -> A LOC_Os06g03760.1 synonymous_variant ; p.Leu60Leu; LOW synonymous_codon Average:90.937; most accessible tissue: Minghui63 flower, score: 95.238 N N N N
vg0601490087 G -> A LOC_Os06g03760.3 synonymous_variant ; p.Leu60Leu; LOW synonymous_codon Average:90.937; most accessible tissue: Minghui63 flower, score: 95.238 N N N N
vg0601490087 G -> A LOC_Os06g03760.2 synonymous_variant ; p.Leu60Leu; LOW synonymous_codon Average:90.937; most accessible tissue: Minghui63 flower, score: 95.238 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0601490087 G A -0.02 -0.02 -0.03 -0.02 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0601490087 NA 9.49E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601490087 NA 1.80E-06 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601490087 NA 1.09E-06 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601490087 NA 1.40E-13 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601490087 NA 9.68E-07 mr1592 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601490087 NA 2.95E-06 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601490087 NA 1.65E-07 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601490087 1.57E-06 1.57E-06 mr1996 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601490087 NA 1.87E-07 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601490087 NA 6.51E-10 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601490087 NA 2.53E-11 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601490087 NA 2.41E-06 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251