\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601481283:

Variant ID: vg0601481283 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 1481283
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:


GTACGACGAGTTTAACACTAGTATCGTTTACCCTTCGGCCTGTAATTTAATCATCATAAATAAAACGATGGTTGTATAAAACGCGTCAAATAAGATTTCT[C/A]
GTAAACAAAGTTTTTTCATCAGACAAATCATCCTTACTCGGGAAACACTCATGCATGAGTCAAGCTGTTGGCTATGACAATTGATGAGAAATGCCCAGGG

Reverse complement sequence

CCCTGGGCATTTCTCATCAATTGTCATAGCCAACAGCTTGACTCATGCATGAGTGTTTCCCGAGTAAGGATGATTTGTCTGATGAAAAAACTTTGTTTAC[G/T]
AGAAATCTTATTTGACGCGTTTTATACAACCATCGTTTTATTTATGATGATTAAATTACAGGCCGAAGGGTAAACGATACTAGTGTTAAACTCGTCGTAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.40% 9.90% 2.69% 0.00% NA
All Indica  2759 92.70% 6.50% 0.80% 0.00% NA
All Japonica  1512 74.80% 18.50% 6.68% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 66.20% 30.10% 3.66% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 94.70% 4.70% 0.64% 0.00% NA
Temperate Japonica  767 68.70% 22.30% 9.00% 0.00% NA
Tropical Japonica  504 87.90% 8.90% 3.17% 0.00% NA
Japonica Intermediate  241 66.80% 26.60% 6.64% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 88.90% 7.80% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0601481283 C -> A LOC_Os06g03740.1 downstream_gene_variant ; 4047.0bp to feature; MODIFIER silent_mutation Average:75.467; most accessible tissue: Callus, score: 91.659 N N N N
vg0601481283 C -> A LOC_Os06g03760.1 downstream_gene_variant ; 4622.0bp to feature; MODIFIER silent_mutation Average:75.467; most accessible tissue: Callus, score: 91.659 N N N N
vg0601481283 C -> A LOC_Os06g03760.3 downstream_gene_variant ; 4622.0bp to feature; MODIFIER silent_mutation Average:75.467; most accessible tissue: Callus, score: 91.659 N N N N
vg0601481283 C -> A LOC_Os06g03760.2 downstream_gene_variant ; 4622.0bp to feature; MODIFIER silent_mutation Average:75.467; most accessible tissue: Callus, score: 91.659 N N N N
vg0601481283 C -> A LOC_Os06g03750.1 intron_variant ; MODIFIER silent_mutation Average:75.467; most accessible tissue: Callus, score: 91.659 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0601481283 NA 3.58E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601481283 1.17E-07 NA mr1137 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601481283 2.74E-06 1.05E-14 mr1141 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601481283 NA 2.39E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601481283 NA 3.11E-06 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601481283 NA 1.13E-07 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601481283 NA 1.22E-07 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601481283 NA 7.33E-06 mr1042_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601481283 5.52E-07 NA mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601481283 NA 1.13E-13 mr1141_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601481283 NA 2.04E-07 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601481283 NA 2.15E-07 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601481283 NA 1.39E-06 mr1399_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601481283 NA 5.44E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601481283 NA 5.12E-06 mr1871_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251