\
| Variant ID: vg0601481283 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 1481283 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 304. )
GTACGACGAGTTTAACACTAGTATCGTTTACCCTTCGGCCTGTAATTTAATCATCATAAATAAAACGATGGTTGTATAAAACGCGTCAAATAAGATTTCT[C/A]
GTAAACAAAGTTTTTTCATCAGACAAATCATCCTTACTCGGGAAACACTCATGCATGAGTCAAGCTGTTGGCTATGACAATTGATGAGAAATGCCCAGGG
CCCTGGGCATTTCTCATCAATTGTCATAGCCAACAGCTTGACTCATGCATGAGTGTTTCCCGAGTAAGGATGATTTGTCTGATGAAAAAACTTTGTTTAC[G/T]
AGAAATCTTATTTGACGCGTTTTATACAACCATCGTTTTATTTATGATGATTAAATTACAGGCCGAAGGGTAAACGATACTAGTGTTAAACTCGTCGTAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.40% | 9.90% | 2.69% | 0.00% | NA |
| All Indica | 2759 | 92.70% | 6.50% | 0.80% | 0.00% | NA |
| All Japonica | 1512 | 74.80% | 18.50% | 6.68% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 66.20% | 30.10% | 3.66% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.70% | 4.70% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 68.70% | 22.30% | 9.00% | 0.00% | NA |
| Tropical Japonica | 504 | 87.90% | 8.90% | 3.17% | 0.00% | NA |
| Japonica Intermediate | 241 | 66.80% | 26.60% | 6.64% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 7.80% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0601481283 | C -> A | LOC_Os06g03740.1 | downstream_gene_variant ; 4047.0bp to feature; MODIFIER | silent_mutation | Average:75.467; most accessible tissue: Callus, score: 91.659 | N | N | N | N |
| vg0601481283 | C -> A | LOC_Os06g03760.1 | downstream_gene_variant ; 4622.0bp to feature; MODIFIER | silent_mutation | Average:75.467; most accessible tissue: Callus, score: 91.659 | N | N | N | N |
| vg0601481283 | C -> A | LOC_Os06g03760.3 | downstream_gene_variant ; 4622.0bp to feature; MODIFIER | silent_mutation | Average:75.467; most accessible tissue: Callus, score: 91.659 | N | N | N | N |
| vg0601481283 | C -> A | LOC_Os06g03760.2 | downstream_gene_variant ; 4622.0bp to feature; MODIFIER | silent_mutation | Average:75.467; most accessible tissue: Callus, score: 91.659 | N | N | N | N |
| vg0601481283 | C -> A | LOC_Os06g03750.1 | intron_variant ; MODIFIER | silent_mutation | Average:75.467; most accessible tissue: Callus, score: 91.659 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0601481283 | NA | 3.58E-06 | mr1077 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601481283 | 1.17E-07 | NA | mr1137 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601481283 | 2.74E-06 | 1.05E-14 | mr1141 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601481283 | NA | 2.39E-07 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601481283 | NA | 3.11E-06 | mr1441 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601481283 | NA | 1.13E-07 | mr1726 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601481283 | NA | 1.22E-07 | mr1805 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601481283 | NA | 7.33E-06 | mr1042_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601481283 | 5.52E-07 | NA | mr1137_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601481283 | NA | 1.13E-13 | mr1141_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601481283 | NA | 2.04E-07 | mr1149_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601481283 | NA | 2.15E-07 | mr1167_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601481283 | NA | 1.39E-06 | mr1399_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601481283 | NA | 5.44E-08 | mr1441_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601481283 | NA | 5.12E-06 | mr1871_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |