\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601470319:

Variant ID: vg0601470319 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 1470319
Reference Allele: TAlternative Allele: C,TC
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


CAACCATTTTACCGAGCACACCCTAATTTGCTTTACCTAGGCCGTGTTTAGTTCCAATTTTTTTTTCAAACTTCCAACTTTTCTATCCTATCAAAATTTT[T/C,TC]
CTACACACACAAATTTTTAACATTTTCGTCACATCGTTCCAATTTTAACCAGACTTTCAATTTTGGCGTGAACTAAACACACCCCTAGCTAACCGGAGAA

Reverse complement sequence

TTCTCCGGTTAGCTAGGGGTGTGTTTAGTTCACGCCAAAATTGAAAGTCTGGTTAAAATTGGAACGATGTGACGAAAATGTTAAAAATTTGTGTGTGTAG[A/G,GA]
AAAATTTTGATAGGATAGAAAAGTTGGAAGTTTGAAAAAAAAATTGGAACTAAACACGGCCTAGGTAAAGCAAATTAGGGTGTGCTCGGTAAAATGGTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.80% 28.40% 0.04% 0.00% TC: 1.76%
All Indica  2759 90.60% 9.30% 0.00% 0.00% TC: 0.07%
All Japonica  1512 27.70% 67.00% 0.13% 0.00% TC: 5.16%
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 60.40% 39.40% 0.00% 0.00% TC: 0.22%
Indica III  913 99.50% 0.40% 0.00% 0.00% TC: 0.11%
Indica Intermediate  786 91.50% 8.50% 0.00% 0.00% NA
Temperate Japonica  767 21.40% 78.50% 0.13% 0.00% NA
Tropical Japonica  504 35.70% 49.40% 0.00% 0.00% TC: 14.88%
Japonica Intermediate  241 31.10% 67.20% 0.41% 0.00% TC: 1.24%
VI/Aromatic  96 64.60% 35.40% 0.00% 0.00% NA
Intermediate  90 56.70% 40.00% 0.00% 0.00% TC: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0601470319 T -> C LOC_Os06g03710.1 upstream_gene_variant ; 1719.0bp to feature; MODIFIER silent_mutation Average:97.266; most accessible tissue: Minghui63 young leaf, score: 98.492 N N N N
vg0601470319 T -> C LOC_Os06g03720.1 upstream_gene_variant ; 546.0bp to feature; MODIFIER silent_mutation Average:97.266; most accessible tissue: Minghui63 young leaf, score: 98.492 N N N N
vg0601470319 T -> C LOC_Os06g03710-LOC_Os06g03720 intergenic_region ; MODIFIER silent_mutation Average:97.266; most accessible tissue: Minghui63 young leaf, score: 98.492 N N N N
vg0601470319 T -> TC LOC_Os06g03710.1 upstream_gene_variant ; 1720.0bp to feature; MODIFIER silent_mutation Average:97.266; most accessible tissue: Minghui63 young leaf, score: 98.492 N N N N
vg0601470319 T -> TC LOC_Os06g03720.1 upstream_gene_variant ; 545.0bp to feature; MODIFIER silent_mutation Average:97.266; most accessible tissue: Minghui63 young leaf, score: 98.492 N N N N
vg0601470319 T -> TC LOC_Os06g03710-LOC_Os06g03720 intergenic_region ; MODIFIER silent_mutation Average:97.266; most accessible tissue: Minghui63 young leaf, score: 98.492 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0601470319 T C 0.0 -0.01 -0.01 -0.01 -0.01 -0.01
vg0601470319 T TC -0.01 -0.03 -0.07 -0.02 -0.04 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0601470319 NA 1.10E-07 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0601470319 NA 6.04E-10 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0601470319 NA 9.95E-06 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601470319 NA 5.23E-15 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601470319 NA 1.72E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601470319 NA 5.17E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601470319 3.69E-06 4.50E-50 mr1141 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601470319 3.86E-09 2.06E-23 mr1141 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601470319 NA 5.81E-17 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601470319 NA 8.96E-17 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601470319 NA 4.91E-08 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601470319 NA 9.78E-06 mr1269 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601470319 NA 3.22E-09 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601470319 NA 3.16E-13 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601470319 NA 3.76E-06 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601470319 NA 3.47E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601470319 NA 1.11E-15 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601470319 NA 8.51E-09 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601470319 NA 9.82E-16 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601470319 NA 3.47E-08 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601470319 NA 1.29E-14 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601470319 NA 1.07E-07 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601470319 NA 8.19E-15 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601470319 NA 1.35E-15 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601470319 NA 4.69E-19 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601470319 NA 4.12E-06 mr1042_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601470319 4.99E-08 9.35E-33 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601470319 NA 9.15E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601470319 3.62E-08 2.22E-23 mr1141_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601470319 NA 3.11E-08 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601470319 NA 5.72E-07 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601470319 NA 3.25E-09 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601470319 NA 6.98E-07 mr1399_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601470319 NA 2.90E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601470319 1.15E-07 3.49E-29 mr1617_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601470319 NA 5.88E-07 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601470319 NA 6.08E-06 mr1871_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251