Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601465470:

Variant ID: vg0601465470 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 1465470
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.67, A: 0.33, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:

TAACATCTCTTTTGGACGACACATCAACCAATGCAATTCAGTTTTGAATTGGATACCATCAAAACAAGAGCAAAATAACAGATGAAAGATGGAAGTATAA[C/A]
TTTCAGATGACACAAACTTCACCATCCATGGAGAAATATAACACATGTTTCATTTCATTCTGATTCTGAACAGAGATTACATGTAGAATGAATGATGAAA

Reverse complement sequence

TTTCATCATTCATTCTACATGTAATCTCTGTTCAGAATCAGAATGAAATGAAACATGTGTTATATTTCTCCATGGATGGTGAAGTTTGTGTCATCTGAAA[G/T]
TTATACTTCCATCTTTCATCTGTTATTTTGCTCTTGTTTTGATGGTATCCAATTCAAAACTGAATTGCATTGGTTGATGTGTCGTCCAAAAGAGATGTTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.00%	47.90%	0.11%	0.00%	NA
All Indica	2759	67.30%	32.50%	0.14%	0.00%	NA
All Japonica	1512	23.60%	76.40%	0.00%	0.00%	NA
Aus	269	67.70%	32.30%	0.00%	0.00%	NA
Indica I	595	91.90%	7.90%	0.17%	0.00%	NA
Indica II	465	44.30%	55.70%	0.00%	0.00%	NA
Indica III	913	63.60%	36.30%	0.11%	0.00%	NA
Indica Intermediate	786	66.70%	33.10%	0.25%	0.00%	NA
Temperate Japonica	767	21.30%	78.70%	0.00%	0.00%	NA
Tropical Japonica	504	24.20%	75.80%	0.00%	0.00%	NA
Japonica Intermediate	241	29.90%	70.10%	0.00%	0.00%	NA
VI/Aromatic	96	24.00%	76.00%	0.00%	0.00%	NA
Intermediate	90	43.30%	55.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0601465470	C -> A	LOC_Os06g03700.1	downstream_gene_variant ; 1131.0bp to feature; MODIFIER	silent_mutation	Average:90.063; most accessible tissue: Callus, score: 94.103	N	N	N	N
vg0601465470	C -> A	LOC_Os06g03710.1	downstream_gene_variant ; 29.0bp to feature; MODIFIER	silent_mutation	Average:90.063; most accessible tissue: Callus, score: 94.103	N	N	N	N
vg0601465470	C -> A	LOC_Os06g03700-LOC_Os06g03710	intergenic_region ; MODIFIER	silent_mutation	Average:90.063; most accessible tissue: Callus, score: 94.103	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0601465470	NA	1.05E-06	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601465470	NA	2.22E-06	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601465470	1.33E-08	NA	mr1137	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601465470	NA	7.08E-09	mr1141	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601465470	NA	6.16E-14	mr1441	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601465470	NA	8.47E-08	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601465470	NA	1.93E-06	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601465470	4.61E-07	NA	mr1617	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601465470	NA	7.43E-10	mr1805	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601465470	NA	6.28E-07	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601465470	NA	2.55E-07	mr1072_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601465470	NA	5.98E-08	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601465470	NA	9.67E-09	mr1077_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601465470	NA	2.59E-09	mr1141_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601465470	NA	1.43E-07	mr1149_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601465470	NA	4.48E-06	mr1233_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601465470	NA	3.88E-08	mr1441_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601465470	NA	3.61E-06	mr1592_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601465470	NA	2.76E-09	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601465470	NA	5.05E-12	mr1805_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251