\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601461905:

Variant ID: vg0601461905 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 1461905
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.11, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


AATGCAGAATCAAATTAGCAGTAAAATAATAACTTTCTCCGTAGTCAAAGGATGGCTAAAAAAAAACTACCATAGAAAAGTGAATAACAGATTTGCTGCA[C/T]
ATGTTCATCAGGGCACTTCATGAAAAGGAACGGAGGAGCAAAGGCGGCATGACACGCACCCAGTTCTTCTTGGTAGCATTTGTGTGCAGCTTTGCCTACT

Reverse complement sequence

AGTAGGCAAAGCTGCACACAAATGCTACCAAGAAGAACTGGGTGCGTGTCATGCCGCCTTTGCTCCTCCGTTCCTTTTCATGAAGTGCCCTGATGAACAT[G/A]
TGCAGCAAATCTGTTATTCACTTTTCTATGGTAGTTTTTTTTTAGCCATCCTTTGACTACGGAGAAAGTTATTATTTTACTGCTAATTTGATTCTGCATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.90% 39.10% 0.02% 0.00% NA
All Indica  2759 40.10% 59.90% 0.00% 0.00% NA
All Japonica  1512 99.40% 0.60% 0.00% 0.00% NA
Aus  269 38.30% 61.70% 0.00% 0.00% NA
Indica I  595 9.40% 90.60% 0.00% 0.00% NA
Indica II  465 60.60% 39.40% 0.00% 0.00% NA
Indica III  913 46.40% 53.60% 0.00% 0.00% NA
Indica Intermediate  786 43.80% 56.20% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 2.10% 1.04% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0601461905 C -> T LOC_Os06g03690.1 downstream_gene_variant ; 3295.0bp to feature; MODIFIER silent_mutation Average:64.456; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0601461905 C -> T LOC_Os06g03710.1 downstream_gene_variant ; 3594.0bp to feature; MODIFIER silent_mutation Average:64.456; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0601461905 C -> T LOC_Os06g03690.2 downstream_gene_variant ; 3180.0bp to feature; MODIFIER silent_mutation Average:64.456; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0601461905 C -> T LOC_Os06g03700.1 intron_variant ; MODIFIER silent_mutation Average:64.456; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0601461905 NA 1.15E-13 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905 NA 6.62E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905 NA 2.54E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905 NA 5.58E-06 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905 NA 3.93E-10 mr1141 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905 NA 5.06E-13 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905 NA 6.68E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905 NA 2.16E-14 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905 NA 5.13E-07 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905 NA 5.52E-14 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905 NA 2.22E-06 mr1592 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905 NA 2.16E-07 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905 NA 3.54E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905 NA 2.80E-06 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905 NA 3.95E-07 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905 NA 4.61E-08 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905 NA 5.46E-06 mr1955 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905 NA 8.76E-11 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905 NA 7.70E-13 mr1222_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905 NA 2.08E-06 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905 NA 2.28E-09 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251