Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601461905:

Variant ID: vg0601461905 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 1461905
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.11, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

AATGCAGAATCAAATTAGCAGTAAAATAATAACTTTCTCCGTAGTCAAAGGATGGCTAAAAAAAAACTACCATAGAAAAGTGAATAACAGATTTGCTGCA[C/T]
ATGTTCATCAGGGCACTTCATGAAAAGGAACGGAGGAGCAAAGGCGGCATGACACGCACCCAGTTCTTCTTGGTAGCATTTGTGTGCAGCTTTGCCTACT

Reverse complement sequence

AGTAGGCAAAGCTGCACACAAATGCTACCAAGAAGAACTGGGTGCGTGTCATGCCGCCTTTGCTCCTCCGTTCCTTTTCATGAAGTGCCCTGATGAACAT[G/A]
TGCAGCAAATCTGTTATTCACTTTTCTATGGTAGTTTTTTTTTAGCCATCCTTTGACTACGGAGAAAGTTATTATTTTACTGCTAATTTGATTCTGCATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.90%	39.10%	0.02%	0.00%	NA
All Indica	2759	40.10%	59.90%	0.00%	0.00%	NA
All Japonica	1512	99.40%	0.60%	0.00%	0.00%	NA
Aus	269	38.30%	61.70%	0.00%	0.00%	NA
Indica I	595	9.40%	90.60%	0.00%	0.00%	NA
Indica II	465	60.60%	39.40%	0.00%	0.00%	NA
Indica III	913	46.40%	53.60%	0.00%	0.00%	NA
Indica Intermediate	786	43.80%	56.20%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	98.60%	1.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	2.10%	1.04%	0.00%	NA
Intermediate	90	78.90%	21.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0601461905	C -> T	LOC_Os06g03690.1	downstream_gene_variant ; 3295.0bp to feature; MODIFIER	silent_mutation	Average:64.456; most accessible tissue: Zhenshan97 panicle, score: 79.071	N	N	N	N
vg0601461905	C -> T	LOC_Os06g03710.1	downstream_gene_variant ; 3594.0bp to feature; MODIFIER	silent_mutation	Average:64.456; most accessible tissue: Zhenshan97 panicle, score: 79.071	N	N	N	N
vg0601461905	C -> T	LOC_Os06g03690.2	downstream_gene_variant ; 3180.0bp to feature; MODIFIER	silent_mutation	Average:64.456; most accessible tissue: Zhenshan97 panicle, score: 79.071	N	N	N	N
vg0601461905	C -> T	LOC_Os06g03700.1	intron_variant ; MODIFIER	silent_mutation	Average:64.456; most accessible tissue: Zhenshan97 panicle, score: 79.071	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0601461905	NA	1.15E-13	mr1069	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905	NA	6.62E-06	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905	NA	2.54E-06	mr1074	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905	NA	5.58E-06	mr1130	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905	NA	3.93E-10	mr1141	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905	NA	5.06E-13	mr1149	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905	NA	6.68E-07	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905	NA	2.16E-14	mr1441	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905	NA	5.13E-07	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905	NA	5.52E-14	mr1592	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905	NA	2.22E-06	mr1592	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905	NA	2.16E-07	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905	NA	3.54E-06	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905	NA	2.80E-06	mr1805	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905	NA	3.95E-07	mr1850	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905	NA	4.61E-08	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905	NA	5.46E-06	mr1955	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905	NA	8.76E-11	mr1124_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905	NA	7.70E-13	mr1222_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905	NA	2.08E-06	mr1222_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601461905	NA	2.28E-09	mr1962_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251