\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601454762:

Variant ID: vg0601454762 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 1454762
Reference Allele: CAlternative Allele: T,CA
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAATGGCCGTATATATCCGGTTGGATGTAGAGGCCGGGTAAAAAATACCCTTCTCTAAAAAAAATAAGAAAAAACAAGTGTAAAATACTCTCTCCGTCC[C/T,CA]
AAAATATAAGAATTTTTGGACCTGACACGGTCTTCGAGATGCTTCTTTGACCAACAATATCTATAAAAGTAAGATGTTTTAAATAAAAAGAGTTGCATAT

Reverse complement sequence

ATATGCAACTCTTTTTATTTAAAACATCTTACTTTTATAGATATTGTTGGTCAAAGAAGCATCTCGAAGACCGTGTCAGGTCCAAAAATTCTTATATTTT[G/A,TG]
GGACGGAGAGAGTATTTTACACTTGTTTTTTCTTATTTTTTTTAGAGAAGGGTATTTTTTACCCGGCCTCTACATCCAACCGGATATATACGGCCATTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.20% 9.10% 0.08% 0.00% CA: 3.64%
All Indica  2759 98.50% 0.50% 0.04% 0.00% CA: 0.94%
All Japonica  1512 67.70% 23.10% 0.20% 0.00% CA: 8.99%
Aus  269 85.90% 12.60% 0.00% 0.00% CA: 1.49%
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 98.50% 1.10% 0.00% 0.00% CA: 0.43%
Indica III  913 97.40% 0.20% 0.00% 0.00% CA: 2.41%
Indica Intermediate  786 98.90% 0.80% 0.13% 0.00% CA: 0.25%
Temperate Japonica  767 78.70% 21.10% 0.13% 0.00% NA
Tropical Japonica  504 50.40% 23.40% 0.20% 0.00% CA: 25.99%
Japonica Intermediate  241 68.90% 28.60% 0.41% 0.00% CA: 2.07%
VI/Aromatic  96 76.00% 22.90% 0.00% 0.00% CA: 1.04%
Intermediate  90 83.30% 11.10% 0.00% 0.00% CA: 5.56%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0601454762 C -> CA LOC_Os06g03690.1 upstream_gene_variant ; 605.0bp to feature; MODIFIER silent_mutation Average:73.12; most accessible tissue: Minghui63 panicle, score: 91.919 N N N N
vg0601454762 C -> CA LOC_Os06g03700.1 upstream_gene_variant ; 4429.0bp to feature; MODIFIER silent_mutation Average:73.12; most accessible tissue: Minghui63 panicle, score: 91.919 N N N N
vg0601454762 C -> CA LOC_Os06g03690.2 upstream_gene_variant ; 620.0bp to feature; MODIFIER silent_mutation Average:73.12; most accessible tissue: Minghui63 panicle, score: 91.919 N N N N
vg0601454762 C -> CA LOC_Os06g03682-LOC_Os06g03690 intergenic_region ; MODIFIER silent_mutation Average:73.12; most accessible tissue: Minghui63 panicle, score: 91.919 N N N N
vg0601454762 C -> T LOC_Os06g03690.1 upstream_gene_variant ; 606.0bp to feature; MODIFIER silent_mutation Average:73.12; most accessible tissue: Minghui63 panicle, score: 91.919 N N N N
vg0601454762 C -> T LOC_Os06g03700.1 upstream_gene_variant ; 4430.0bp to feature; MODIFIER silent_mutation Average:73.12; most accessible tissue: Minghui63 panicle, score: 91.919 N N N N
vg0601454762 C -> T LOC_Os06g03690.2 upstream_gene_variant ; 621.0bp to feature; MODIFIER silent_mutation Average:73.12; most accessible tissue: Minghui63 panicle, score: 91.919 N N N N
vg0601454762 C -> T LOC_Os06g03682-LOC_Os06g03690 intergenic_region ; MODIFIER silent_mutation Average:73.12; most accessible tissue: Minghui63 panicle, score: 91.919 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0601454762 C CA 0.11 0.11 0.09 0.06 0.1 0.13
vg0601454762 C T 0.01 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0601454762 NA 8.95E-19 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0601454762 NA 1.92E-09 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0601454762 1.70E-08 NA mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601454762 2.32E-06 NA mr1137_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601454762 6.86E-07 NA mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601454762 3.46E-06 1.71E-06 mr1617_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251