Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601448111:

Variant ID: vg0601448111 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 1448111
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTCCCACACGCTGGAATCAGACGAGATTCTCCGCTGAAATCTCTCACCGACTCCCCCCCCCCCCCCCCCCACCTCAGTGCATCATCCTTGCTTCTTCGGC[C/A]
ACTGAATCTGGGCACGAACACAAACCGAGCAGAGAAAATCCAAAGCTTTTTAGCGCTCTCGAAACCCCAAAATCGCGGGCTTTTCCATACAAATCCCCAC

Reverse complement sequence

GTGGGGATTTGTATGGAAAAGCCCGCGATTTTGGGGTTTCGAGAGCGCTAAAAAGCTTTGGATTTTCTCTGCTCGGTTTGTGTTCGTGCCCAGATTCAGT[G/T]
GCCGAAGAAGCAAGGATGATGCACTGAGGTGGGGGGGGGGGGGGGGGGAGTCGGTGAGAGATTTCAGCGGAGAATCTCGTCTGATTCCAGCGTGTGGGAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.50%	10.50%	0.06%	0.00%	NA
All Indica	2759	86.50%	13.40%	0.07%	0.00%	NA
All Japonica	1512	94.10%	5.90%	0.00%	0.00%	NA
Aus	269	92.60%	7.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	75.10%	24.90%	0.00%	0.00%	NA
Indica III	913	84.10%	15.80%	0.11%	0.00%	NA
Indica Intermediate	786	85.90%	14.00%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	82.90%	17.10%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	81.10%	17.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0601448111	C -> A	LOC_Os06g03682.1	5_prime_UTR_premature_start_codon_gain_variant ; LOW	silent_mutation	Average:90.698; most accessible tissue: Zhenshan97 panicle, score: 95.705	N	N	N	N
vg0601448111	C -> A	LOC_Os06g03682.1	5_prime_UTR_variant ; 110.0bp to feature; MODIFIER	silent_mutation	Average:90.698; most accessible tissue: Zhenshan97 panicle, score: 95.705	N	N	N	N
vg0601448111	C -> A	LOC_Os06g03676.1	upstream_gene_variant ; 2948.0bp to feature; MODIFIER	silent_mutation	Average:90.698; most accessible tissue: Zhenshan97 panicle, score: 95.705	N	N	N	N
vg0601448111	C -> A	LOC_Os06g03682.2	intron_variant ; MODIFIER	silent_mutation	Average:90.698; most accessible tissue: Zhenshan97 panicle, score: 95.705	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0601448111	C	A	0.0	0.0	-0.01	-0.01	-0.02	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0601448111	NA	2.63E-06	mr1122	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601448111	9.74E-06	3.25E-08	mr1310	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601448111	NA	9.38E-07	mr1354	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601448111	2.90E-06	2.90E-06	mr1442	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601448111	NA	1.18E-08	mr1498	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601448111	NA	7.54E-06	mr1570	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601448111	NA	1.95E-06	mr1583	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601448111	NA	6.27E-13	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601448111	NA	7.67E-09	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601448111	NA	7.70E-08	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601448111	NA	6.98E-06	mr1322_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601448111	NA	1.90E-06	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601448111	NA	4.80E-11	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251