\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601384228:

Variant ID: vg0601384228 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 1384228
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.65, T: 0.35, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


ATCCGCCGCCGATCGCCGGCGCCGGAGAAGCACACGTCGATGGCCTCGACGACGAGGTTCTTGATTATGTGATTGGTGATGTTCTTCAGGATCAGGTATG[C/T]
ATTTGATCCAACCTTTCCATCATTATTAGCATACTGCTCTTACAGGCTTGCAGAATGATGAGCTTTAGCATCAAACATATGTTTCTAAGCCTTTGATATG

Reverse complement sequence

CATATCAAAGGCTTAGAAACATATGTTTGATGCTAAAGCTCATCATTCTGCAAGCCTGTAAGAGCAGTATGCTAATAATGATGGAAAGGTTGGATCAAAT[G/A]
CATACCTGATCCTGAAGAACATCACCAATCACATAATCAAGAACCTCGTCGTCGAGGCCATCGACGTGTGCTTCTCCGGCGCCGGCGATCGGCGGCGGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.20% 22.70% 0.15% 0.00% NA
All Indica  2759 76.70% 23.10% 0.25% 0.00% NA
All Japonica  1512 84.80% 15.20% 0.00% 0.00% NA
Aus  269 55.40% 44.60% 0.00% 0.00% NA
Indica I  595 94.50% 5.50% 0.00% 0.00% NA
Indica II  465 69.90% 29.20% 0.86% 0.00% NA
Indica III  913 68.20% 31.70% 0.11% 0.00% NA
Indica Intermediate  786 77.10% 22.60% 0.25% 0.00% NA
Temperate Japonica  767 96.20% 3.80% 0.00% 0.00% NA
Tropical Japonica  504 70.00% 30.00% 0.00% 0.00% NA
Japonica Intermediate  241 79.30% 20.70% 0.00% 0.00% NA
VI/Aromatic  96 38.50% 61.50% 0.00% 0.00% NA
Intermediate  90 70.00% 30.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0601384228 C -> T LOC_Os06g03580.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:76.434; most accessible tissue: Callus, score: 84.066 N N N N
vg0601384228 C -> T LOC_Os06g03580.3 splice_region_variant&intron_variant ; LOW silent_mutation Average:76.434; most accessible tissue: Callus, score: 84.066 N N N N
vg0601384228 C -> T LOC_Os06g03580.2 splice_region_variant&intron_variant ; LOW silent_mutation Average:76.434; most accessible tissue: Callus, score: 84.066 N N N N
vg0601384228 C -> T LOC_Os06g03580.4 5_prime_UTR_variant ; 246.0bp to feature; MODIFIER silent_mutation Average:76.434; most accessible tissue: Callus, score: 84.066 N N N N
vg0601384228 C -> T LOC_Os06g03590.1 upstream_gene_variant ; 3752.0bp to feature; MODIFIER silent_mutation Average:76.434; most accessible tissue: Callus, score: 84.066 N N N N
vg0601384228 C -> T LOC_Os06g03570.2 downstream_gene_variant ; 4774.0bp to feature; MODIFIER silent_mutation Average:76.434; most accessible tissue: Callus, score: 84.066 N N N N
vg0601384228 C -> T LOC_Os06g03600.1 downstream_gene_variant ; 4785.0bp to feature; MODIFIER silent_mutation Average:76.434; most accessible tissue: Callus, score: 84.066 N N N N
vg0601384228 C -> T LOC_Os06g03570.1 downstream_gene_variant ; 4774.0bp to feature; MODIFIER silent_mutation Average:76.434; most accessible tissue: Callus, score: 84.066 N N N N
vg0601384228 C -> T LOC_Os06g03600.3 downstream_gene_variant ; 4785.0bp to feature; MODIFIER silent_mutation Average:76.434; most accessible tissue: Callus, score: 84.066 N N N N
vg0601384228 C -> T LOC_Os06g03600.2 downstream_gene_variant ; 4785.0bp to feature; MODIFIER silent_mutation Average:76.434; most accessible tissue: Callus, score: 84.066 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0601384228 2.20E-06 1.08E-08 mr1310 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601384228 7.05E-06 5.81E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601384228 3.10E-06 3.36E-08 mr1252_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601384228 NA 5.11E-06 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601384228 5.94E-06 5.94E-06 mr1597_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601384228 NA 1.69E-07 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601384228 NA 6.16E-07 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251