\
| Variant ID: vg0601384228 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 1384228 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.65, T: 0.35, others allele: 0.00, population size: 259. )
ATCCGCCGCCGATCGCCGGCGCCGGAGAAGCACACGTCGATGGCCTCGACGACGAGGTTCTTGATTATGTGATTGGTGATGTTCTTCAGGATCAGGTATG[C/T]
ATTTGATCCAACCTTTCCATCATTATTAGCATACTGCTCTTACAGGCTTGCAGAATGATGAGCTTTAGCATCAAACATATGTTTCTAAGCCTTTGATATG
CATATCAAAGGCTTAGAAACATATGTTTGATGCTAAAGCTCATCATTCTGCAAGCCTGTAAGAGCAGTATGCTAATAATGATGGAAAGGTTGGATCAAAT[G/A]
CATACCTGATCCTGAAGAACATCACCAATCACATAATCAAGAACCTCGTCGTCGAGGCCATCGACGTGTGCTTCTCCGGCGCCGGCGATCGGCGGCGGAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.20% | 22.70% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 76.70% | 23.10% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 84.80% | 15.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 55.40% | 44.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.50% | 5.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 69.90% | 29.20% | 0.86% | 0.00% | NA |
| Indica III | 913 | 68.20% | 31.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 77.10% | 22.60% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 96.20% | 3.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 70.00% | 30.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 79.30% | 20.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 38.50% | 61.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 30.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0601384228 | C -> T | LOC_Os06g03580.1 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:76.434; most accessible tissue: Callus, score: 84.066 | N | N | N | N |
| vg0601384228 | C -> T | LOC_Os06g03580.3 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:76.434; most accessible tissue: Callus, score: 84.066 | N | N | N | N |
| vg0601384228 | C -> T | LOC_Os06g03580.2 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:76.434; most accessible tissue: Callus, score: 84.066 | N | N | N | N |
| vg0601384228 | C -> T | LOC_Os06g03580.4 | 5_prime_UTR_variant ; 246.0bp to feature; MODIFIER | silent_mutation | Average:76.434; most accessible tissue: Callus, score: 84.066 | N | N | N | N |
| vg0601384228 | C -> T | LOC_Os06g03590.1 | upstream_gene_variant ; 3752.0bp to feature; MODIFIER | silent_mutation | Average:76.434; most accessible tissue: Callus, score: 84.066 | N | N | N | N |
| vg0601384228 | C -> T | LOC_Os06g03570.2 | downstream_gene_variant ; 4774.0bp to feature; MODIFIER | silent_mutation | Average:76.434; most accessible tissue: Callus, score: 84.066 | N | N | N | N |
| vg0601384228 | C -> T | LOC_Os06g03600.1 | downstream_gene_variant ; 4785.0bp to feature; MODIFIER | silent_mutation | Average:76.434; most accessible tissue: Callus, score: 84.066 | N | N | N | N |
| vg0601384228 | C -> T | LOC_Os06g03570.1 | downstream_gene_variant ; 4774.0bp to feature; MODIFIER | silent_mutation | Average:76.434; most accessible tissue: Callus, score: 84.066 | N | N | N | N |
| vg0601384228 | C -> T | LOC_Os06g03600.3 | downstream_gene_variant ; 4785.0bp to feature; MODIFIER | silent_mutation | Average:76.434; most accessible tissue: Callus, score: 84.066 | N | N | N | N |
| vg0601384228 | C -> T | LOC_Os06g03600.2 | downstream_gene_variant ; 4785.0bp to feature; MODIFIER | silent_mutation | Average:76.434; most accessible tissue: Callus, score: 84.066 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0601384228 | 2.20E-06 | 1.08E-08 | mr1310 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601384228 | 7.05E-06 | 5.81E-07 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601384228 | 3.10E-06 | 3.36E-08 | mr1252_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601384228 | NA | 5.11E-06 | mr1310_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601384228 | 5.94E-06 | 5.94E-06 | mr1597_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601384228 | NA | 1.69E-07 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601384228 | NA | 6.16E-07 | mr1951_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |