\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601362892:

Variant ID: vg0601362892 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 1362892
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAATCTGGAGGCCCAGCACGGACGATTACCTGCGGCCCAAGAATGGGGAAGTGATTAGCCCATACTAATTGGGCCATGATGGGATTCTGACTAATTGGG[C/A]
CTGAACAGGATTTCGATTTCTCACGGCCCACAAACGGATTTCAGTTTACGTGTGCGGCCCATATTTGCAGATTGGTAGCGATCGGAAATTTTACAGATTG

Reverse complement sequence

CAATCTGTAAAATTTCCGATCGCTACCAATCTGCAAATATGGGCCGCACACGTAAACTGAAATCCGTTTGTGGGCCGTGAGAAATCGAAATCCTGTTCAG[G/T]
CCCAATTAGTCAGAATCCCATCATGGCCCAATTAGTATGGGCTAATCACTTCCCCATTCTTGGGCCGCAGGTAATCGTCCGTGCTGGGCCTCCAGATTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.90% 8.90% 0.13% 0.00% NA
All Indica  2759 92.40% 7.50% 0.14% 0.00% NA
All Japonica  1512 89.00% 10.80% 0.13% 0.00% NA
Aus  269 92.60% 7.40% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 90.50% 9.20% 0.22% 0.00% NA
Indica III  913 88.40% 11.50% 0.11% 0.00% NA
Indica Intermediate  786 92.60% 7.10% 0.25% 0.00% NA
Temperate Japonica  767 96.30% 3.40% 0.26% 0.00% NA
Tropical Japonica  504 81.90% 18.10% 0.00% 0.00% NA
Japonica Intermediate  241 80.50% 19.50% 0.00% 0.00% NA
VI/Aromatic  96 78.10% 21.90% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0601362892 C -> A LOC_Os06g03530.1 upstream_gene_variant ; 107.0bp to feature; MODIFIER silent_mutation Average:99.431; most accessible tissue: Minghui63 panicle, score: 99.705 N N N N
vg0601362892 C -> A LOC_Os06g03514.2 downstream_gene_variant ; 3844.0bp to feature; MODIFIER silent_mutation Average:99.431; most accessible tissue: Minghui63 panicle, score: 99.705 N N N N
vg0601362892 C -> A LOC_Os06g03520.1 downstream_gene_variant ; 383.0bp to feature; MODIFIER silent_mutation Average:99.431; most accessible tissue: Minghui63 panicle, score: 99.705 N N N N
vg0601362892 C -> A LOC_Os06g03540.1 downstream_gene_variant ; 2014.0bp to feature; MODIFIER silent_mutation Average:99.431; most accessible tissue: Minghui63 panicle, score: 99.705 N N N N
vg0601362892 C -> A LOC_Os06g03514.1 downstream_gene_variant ; 3846.0bp to feature; MODIFIER silent_mutation Average:99.431; most accessible tissue: Minghui63 panicle, score: 99.705 N N N N
vg0601362892 C -> A LOC_Os06g03520-LOC_Os06g03530 intergenic_region ; MODIFIER silent_mutation Average:99.431; most accessible tissue: Minghui63 panicle, score: 99.705 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0601362892 C A -0.08 -0.18 -0.12 -0.13 -0.08 -0.11

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0601362892 5.51E-07 NA mr1695 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601362892 5.78E-06 7.73E-08 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601362892 NA 3.07E-07 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601362892 NA 8.69E-06 mr1695_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251