\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601360040:

Variant ID: vg0601360040 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 1360040
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTACTATATTTTAAAAAAAAACTTTGGAAAGTTTGAAAAAAAATCAAACAACTTATAATATGAAATGGAGTACTAATCAGAGAGCCAAAACGGCCCCTTT[G/A]
AATCGTAGGAATGAAAAACGAAGAAATAGGAAAAACACAGGATTTTAATAGGAATGGAAGTGTAAAACATAGGATTGCAAAACACACAGGAACGGTCGTT

Reverse complement sequence

AACGACCGTTCCTGTGTGTTTTGCAATCCTATGTTTTACACTTCCATTCCTATTAAAATCCTGTGTTTTTCCTATTTCTTCGTTTTTCATTCCTACGATT[C/T]
AAAGGGGCCGTTTTGGCTCTCTGATTAGTACTCCATTTCATATTATAAGTTGTTTGATTTTTTTTCAAACTTTCCAAAGTTTTTTTTTAAAATATAGTAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.40% 4.60% 0.00% 0.00% NA
All Indica  2759 97.40% 2.60% 0.00% 0.00% NA
All Japonica  1512 90.90% 9.10% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 93.30% 6.70% 0.00% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 95.70% 4.30% 0.00% 0.00% NA
Temperate Japonica  767 85.50% 14.50% 0.00% 0.00% NA
Tropical Japonica  504 96.20% 3.80% 0.00% 0.00% NA
Japonica Intermediate  241 96.70% 3.30% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0601360040 G -> A LOC_Os06g03520.1 upstream_gene_variant ; 1324.0bp to feature; MODIFIER silent_mutation Average:40.999; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0601360040 G -> A LOC_Os06g03530.1 upstream_gene_variant ; 2959.0bp to feature; MODIFIER silent_mutation Average:40.999; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0601360040 G -> A LOC_Os06g03514.2 downstream_gene_variant ; 992.0bp to feature; MODIFIER silent_mutation Average:40.999; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0601360040 G -> A LOC_Os06g03540.1 downstream_gene_variant ; 4866.0bp to feature; MODIFIER silent_mutation Average:40.999; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0601360040 G -> A LOC_Os06g03514.1 downstream_gene_variant ; 994.0bp to feature; MODIFIER silent_mutation Average:40.999; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0601360040 G -> A LOC_Os06g03514-LOC_Os06g03520 intergenic_region ; MODIFIER silent_mutation Average:40.999; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0601360040 2.15E-06 NA Spikelet_length All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0601360040 9.42E-06 9.41E-06 mr1577 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601360040 NA 2.54E-08 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601360040 NA 1.32E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601360040 4.21E-06 NA mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601360040 NA 9.59E-09 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601360040 NA 1.54E-09 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601360040 9.63E-06 NA mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601360040 NA 3.86E-09 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601360040 NA 6.37E-07 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251