\
| Variant ID: vg0601360040 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 1360040 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTACTATATTTTAAAAAAAAACTTTGGAAAGTTTGAAAAAAAATCAAACAACTTATAATATGAAATGGAGTACTAATCAGAGAGCCAAAACGGCCCCTTT[G/A]
AATCGTAGGAATGAAAAACGAAGAAATAGGAAAAACACAGGATTTTAATAGGAATGGAAGTGTAAAACATAGGATTGCAAAACACACAGGAACGGTCGTT
AACGACCGTTCCTGTGTGTTTTGCAATCCTATGTTTTACACTTCCATTCCTATTAAAATCCTGTGTTTTTCCTATTTCTTCGTTTTTCATTCCTACGATT[C/T]
AAAGGGGCCGTTTTGGCTCTCTGATTAGTACTCCATTTCATATTATAAGTTGTTTGATTTTTTTTCAAACTTTCCAAAGTTTTTTTTTAAAATATAGTAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 90.90% | 9.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.70% | 4.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 85.50% | 14.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.20% | 3.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0601360040 | G -> A | LOC_Os06g03520.1 | upstream_gene_variant ; 1324.0bp to feature; MODIFIER | silent_mutation | Average:40.999; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0601360040 | G -> A | LOC_Os06g03530.1 | upstream_gene_variant ; 2959.0bp to feature; MODIFIER | silent_mutation | Average:40.999; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0601360040 | G -> A | LOC_Os06g03514.2 | downstream_gene_variant ; 992.0bp to feature; MODIFIER | silent_mutation | Average:40.999; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0601360040 | G -> A | LOC_Os06g03540.1 | downstream_gene_variant ; 4866.0bp to feature; MODIFIER | silent_mutation | Average:40.999; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0601360040 | G -> A | LOC_Os06g03514.1 | downstream_gene_variant ; 994.0bp to feature; MODIFIER | silent_mutation | Average:40.999; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0601360040 | G -> A | LOC_Os06g03514-LOC_Os06g03520 | intergenic_region ; MODIFIER | silent_mutation | Average:40.999; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0601360040 | 2.15E-06 | NA | Spikelet_length | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0601360040 | 9.42E-06 | 9.41E-06 | mr1577 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601360040 | NA | 2.54E-08 | mr1624 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601360040 | NA | 1.32E-08 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601360040 | 4.21E-06 | NA | mr1549_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601360040 | NA | 9.59E-09 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601360040 | NA | 1.54E-09 | mr1624_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601360040 | 9.63E-06 | NA | mr1757_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601360040 | NA | 3.86E-09 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601360040 | NA | 6.37E-07 | mr1780_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |