Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601277802:

Variant ID: vg0601277802 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 1277802
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

AAATGTGTCGTATCTAAATATGGGACTTTTGTTGGAAAAGGTTATGACAGCTGAGGCTTGTTCCGCTTTTCTTTGAATGACATGTGTAATAATCATAATG[C/T]
TGTGAACCACATTAGTGAGAATGATGAGTCTAATGTGTGGCATTCGCGACTCTGTCATGTGAATTTCGGTTGTATGACGCGCTTAGCTAACATGAGTTTA

Reverse complement sequence

TAAACTCATGTTAGCTAAGCGCGTCATACAACCGAAATTCACATGACAGAGTCGCGAATGCCACACATTAGACTCATCATTCTCACTAATGTGGTTCACA[G/A]
CATTATGATTATTACACATGTCATTCAAAGAAAAGCGGAACAAGCCTCAGCTGTCATAACCTTTTCCAACAAAAGTCCCATATTTAGATACGACACATTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.10%	1.80%	15.32%	16.78%	NA
All Indica	2759	57.70%	2.80%	20.41%	19.06%	NA
All Japonica	1512	81.70%	0.10%	5.36%	12.83%	NA
Aus	269	64.30%	2.60%	19.70%	13.38%	NA
Indica I	595	76.50%	0.00%	9.75%	13.78%	NA
Indica II	465	81.70%	9.50%	5.81%	3.01%	NA
Indica III	913	31.20%	0.80%	36.58%	31.43%	NA
Indica Intermediate	786	60.20%	3.30%	18.32%	18.19%	NA
Temperate Japonica	767	90.00%	0.00%	1.30%	8.74%	NA
Tropical Japonica	504	63.70%	0.20%	13.69%	22.42%	NA
Japonica Intermediate	241	93.40%	0.00%	0.83%	5.81%	NA
VI/Aromatic	96	50.00%	0.00%	17.71%	32.29%	NA
Intermediate	90	81.10%	1.10%	11.11%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0601277802	C -> T	LOC_Os06g03350.1	upstream_gene_variant ; 3632.0bp to feature; MODIFIER	silent_mutation	Average:19.012; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0601277802	C -> T	LOC_Os06g03360.1	upstream_gene_variant ; 4789.0bp to feature; MODIFIER	silent_mutation	Average:19.012; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0601277802	C -> T	LOC_Os06g03330.1	downstream_gene_variant ; 3110.0bp to feature; MODIFIER	silent_mutation	Average:19.012; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0601277802	C -> T	LOC_Os06g03340.1	intron_variant ; MODIFIER	silent_mutation	Average:19.012; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0601277802	C -> DEL	N	N	silent_mutation	Average:19.012; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0601277802	NA	3.98E-06	mr1297	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601277802	9.73E-07	4.38E-11	mr1310	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601277802	NA	3.12E-06	mr1433	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601277802	NA	5.80E-14	mr1498	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601277802	2.77E-06	2.77E-06	mr1663	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601277802	NA	5.94E-09	mr1769	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601277802	NA	1.03E-08	mr1889	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601277802	NA	3.82E-09	mr1896	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601277802	NA	4.28E-11	mr1907	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601277802	NA	1.85E-08	mr1925	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601277802	NA	3.08E-08	mr1951	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601277802	NA	7.52E-07	mr1956	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601277802	NA	1.87E-07	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601277802	NA	1.16E-06	mr1322_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601277802	NA	1.65E-08	mr1498_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601277802	NA	4.45E-06	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601277802	NA	3.98E-06	mr1732_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601277802	NA	1.95E-09	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601277802	NA	1.08E-08	mr1934_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601277802	NA	2.15E-07	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251