\
| Variant ID: vg0601266368 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 1266368 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGAAAGTCACAGGCAGCGTGATTTTGCCCATTGGTTTGGACGAAGACTAGGGAGTAATTCTATGGAAGGGTTGATCGGTGGGTGTCAACTCGCTTCGTGG[G/T]
ATTCCCATGGCGTCCAATGTGCTGGCGAAGAGGAGGTTGATTGAGCTGCCACCGTCGATGAGAACCCGCACGACCTTGATGTTCCGAATAGTGGGTTCGA
TCGAACCCACTATTCGGAACATCAAGGTCGTGCGGGTTCTCATCGACGGTGGCAGCTCAATCAACCTCCTCTTCGCCAGCACATTGGACGCCATGGGAAT[C/A]
CCACGAAGCGAGTTGACACCCACCGATCAACCCTTCCATAGAATTACTCCCTAGTCTTCGTCCAAACCAATGGGCAAAATCACGCTGCCTGTGACTTTCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.00% | 0.40% | 0.78% | 7.83% | NA |
| All Indica | 2759 | 86.70% | 0.60% | 0.87% | 11.82% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 80.30% | 0.70% | 4.83% | 14.13% | NA |
| Indica I | 595 | 66.70% | 0.00% | 0.67% | 32.61% | NA |
| Indica II | 465 | 93.10% | 0.00% | 0.65% | 6.24% | NA |
| Indica III | 913 | 95.00% | 1.10% | 1.31% | 2.63% | NA |
| Indica Intermediate | 786 | 88.50% | 0.80% | 0.64% | 10.05% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 0.00% | 0.00% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0601266368 | G -> T | LOC_Os06g03320.1 | synonymous_variant ; p.Ile845Ile; LOW | synonymous_codon | Average:37.928; most accessible tissue: Minghui63 young leaf, score: 58.21 | N | N | N | N |
| vg0601266368 | G -> DEL | LOC_Os06g03320.1 | N | frameshift_variant | Average:37.928; most accessible tissue: Minghui63 young leaf, score: 58.21 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0601266368 | NA | 9.28E-07 | mr1060 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601266368 | NA | 9.79E-06 | mr1138 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601266368 | NA | 1.81E-06 | mr1380 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601266368 | 4.22E-06 | 4.75E-07 | mr1380 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601266368 | NA | 3.34E-06 | mr1561 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601266368 | NA | 4.09E-06 | mr1728 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601266368 | NA | 7.99E-06 | mr1937 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601266368 | NA | 6.38E-08 | mr1937 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |