\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601266368:

Variant ID: vg0601266368 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 1266368
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGAAAGTCACAGGCAGCGTGATTTTGCCCATTGGTTTGGACGAAGACTAGGGAGTAATTCTATGGAAGGGTTGATCGGTGGGTGTCAACTCGCTTCGTGG[G/T]
ATTCCCATGGCGTCCAATGTGCTGGCGAAGAGGAGGTTGATTGAGCTGCCACCGTCGATGAGAACCCGCACGACCTTGATGTTCCGAATAGTGGGTTCGA

Reverse complement sequence

TCGAACCCACTATTCGGAACATCAAGGTCGTGCGGGTTCTCATCGACGGTGGCAGCTCAATCAACCTCCTCTTCGCCAGCACATTGGACGCCATGGGAAT[C/A]
CCACGAAGCGAGTTGACACCCACCGATCAACCCTTCCATAGAATTACTCCCTAGTCTTCGTCCAAACCAATGGGCAAAATCACGCTGCCTGTGACTTTCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.00% 0.40% 0.78% 7.83% NA
All Indica  2759 86.70% 0.60% 0.87% 11.82% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 80.30% 0.70% 4.83% 14.13% NA
Indica I  595 66.70% 0.00% 0.67% 32.61% NA
Indica II  465 93.10% 0.00% 0.65% 6.24% NA
Indica III  913 95.00% 1.10% 1.31% 2.63% NA
Indica Intermediate  786 88.50% 0.80% 0.64% 10.05% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 0.00% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0601266368 G -> T LOC_Os06g03320.1 synonymous_variant ; p.Ile845Ile; LOW synonymous_codon Average:37.928; most accessible tissue: Minghui63 young leaf, score: 58.21 N N N N
vg0601266368 G -> DEL LOC_Os06g03320.1 N frameshift_variant Average:37.928; most accessible tissue: Minghui63 young leaf, score: 58.21 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0601266368 NA 9.28E-07 mr1060 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601266368 NA 9.79E-06 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601266368 NA 1.81E-06 mr1380 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601266368 4.22E-06 4.75E-07 mr1380 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601266368 NA 3.34E-06 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601266368 NA 4.09E-06 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601266368 NA 7.99E-06 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601266368 NA 6.38E-08 mr1937 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251