Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0601227919:

Variant ID: vg0601227919 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 1227919
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.05, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

CTTGTCTGAGTAGGTCTCTTTACATCTGCCAATTCCGCGAAGGATTTCCTTAACTCATACAGAGTATGTCCATGTATGCACGGGCATGCCATATCGACAT[G/A]
TGACATACATCGAAGGGTAAGGGGTATCCCTAACCCGTAACCCTGATAGTAGCCCCCGACTTCTGCTTAAATGAACTCATGTGACCAATCGCGACTTCTG

Reverse complement sequence

CAGAAGTCGCGATTGGTCACATGAGTTCATTTAAGCAGAAGTCGGGGGCTACTATCAGGGTTACGGGTTAGGGATACCCCTTACCCTTCGATGTATGTCA[C/T]
ATGTCGATATGGCATGCCCGTGCATACATGGACATACTCTGTATGAGTTAAGGAAATCCTTCGCGGAATTGGCAGATGTAAAGAGACCTACTCAGACAAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.30%	47.60%	0.08%	0.00%	NA
All Indica	2759	30.60%	69.30%	0.14%	0.00%	NA
All Japonica	1512	93.70%	6.30%	0.00%	0.00%	NA
Aus	269	23.00%	77.00%	0.00%	0.00%	NA
Indica I	595	8.70%	91.30%	0.00%	0.00%	NA
Indica II	465	56.80%	43.00%	0.22%	0.00%	NA
Indica III	913	33.00%	67.00%	0.00%	0.00%	NA
Indica Intermediate	786	28.80%	70.90%	0.38%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	82.30%	17.70%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	2.50%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	66.70%	33.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0601227919	G -> A	LOC_Os06g03250.1	upstream_gene_variant ; 2829.0bp to feature; MODIFIER	silent_mutation	Average:40.375; most accessible tissue: Minghui63 young leaf, score: 66.656	N	N	N	N
vg0601227919	G -> A	LOC_Os06g03240.1	downstream_gene_variant ; 4275.0bp to feature; MODIFIER	silent_mutation	Average:40.375; most accessible tissue: Minghui63 young leaf, score: 66.656	N	N	N	N
vg0601227919	G -> A	LOC_Os06g03240-LOC_Os06g03250	intergenic_region ; MODIFIER	silent_mutation	Average:40.375; most accessible tissue: Minghui63 young leaf, score: 66.656	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0601227919	NA	3.03E-07	mr1072	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601227919	NA	9.11E-06	mr1137	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601227919	NA	4.46E-10	mr1141	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601227919	NA	2.26E-13	mr1441	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601227919	NA	1.75E-06	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601227919	NA	3.11E-08	mr1805	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601227919	7.17E-06	6.26E-08	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601227919	NA	2.35E-06	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251