\
| Variant ID: vg0601227919 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 1227919 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.05, others allele: 0.00, population size: 209. )
CTTGTCTGAGTAGGTCTCTTTACATCTGCCAATTCCGCGAAGGATTTCCTTAACTCATACAGAGTATGTCCATGTATGCACGGGCATGCCATATCGACAT[G/A]
TGACATACATCGAAGGGTAAGGGGTATCCCTAACCCGTAACCCTGATAGTAGCCCCCGACTTCTGCTTAAATGAACTCATGTGACCAATCGCGACTTCTG
CAGAAGTCGCGATTGGTCACATGAGTTCATTTAAGCAGAAGTCGGGGGCTACTATCAGGGTTACGGGTTAGGGATACCCCTTACCCTTCGATGTATGTCA[C/T]
ATGTCGATATGGCATGCCCGTGCATACATGGACATACTCTGTATGAGTTAAGGAAATCCTTCGCGGAATTGGCAGATGTAAAGAGACCTACTCAGACAAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.30% | 47.60% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 30.60% | 69.30% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 93.70% | 6.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 23.00% | 77.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 8.70% | 91.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 56.80% | 43.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 33.00% | 67.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 28.80% | 70.90% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 82.30% | 17.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 33.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0601227919 | G -> A | LOC_Os06g03250.1 | upstream_gene_variant ; 2829.0bp to feature; MODIFIER | silent_mutation | Average:40.375; most accessible tissue: Minghui63 young leaf, score: 66.656 | N | N | N | N |
| vg0601227919 | G -> A | LOC_Os06g03240.1 | downstream_gene_variant ; 4275.0bp to feature; MODIFIER | silent_mutation | Average:40.375; most accessible tissue: Minghui63 young leaf, score: 66.656 | N | N | N | N |
| vg0601227919 | G -> A | LOC_Os06g03240-LOC_Os06g03250 | intergenic_region ; MODIFIER | silent_mutation | Average:40.375; most accessible tissue: Minghui63 young leaf, score: 66.656 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0601227919 | NA | 3.03E-07 | mr1072 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601227919 | NA | 9.11E-06 | mr1137 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601227919 | NA | 4.46E-10 | mr1141 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601227919 | NA | 2.26E-13 | mr1441 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601227919 | NA | 1.75E-06 | mr1441 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601227919 | NA | 3.11E-08 | mr1805 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601227919 | 7.17E-06 | 6.26E-08 | mr1861 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601227919 | NA | 2.35E-06 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |