\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601227919:

Variant ID: vg0601227919 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 1227919
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.05, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


CTTGTCTGAGTAGGTCTCTTTACATCTGCCAATTCCGCGAAGGATTTCCTTAACTCATACAGAGTATGTCCATGTATGCACGGGCATGCCATATCGACAT[G/A]
TGACATACATCGAAGGGTAAGGGGTATCCCTAACCCGTAACCCTGATAGTAGCCCCCGACTTCTGCTTAAATGAACTCATGTGACCAATCGCGACTTCTG

Reverse complement sequence

CAGAAGTCGCGATTGGTCACATGAGTTCATTTAAGCAGAAGTCGGGGGCTACTATCAGGGTTACGGGTTAGGGATACCCCTTACCCTTCGATGTATGTCA[C/T]
ATGTCGATATGGCATGCCCGTGCATACATGGACATACTCTGTATGAGTTAAGGAAATCCTTCGCGGAATTGGCAGATGTAAAGAGACCTACTCAGACAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.30% 47.60% 0.08% 0.00% NA
All Indica  2759 30.60% 69.30% 0.14% 0.00% NA
All Japonica  1512 93.70% 6.30% 0.00% 0.00% NA
Aus  269 23.00% 77.00% 0.00% 0.00% NA
Indica I  595 8.70% 91.30% 0.00% 0.00% NA
Indica II  465 56.80% 43.00% 0.22% 0.00% NA
Indica III  913 33.00% 67.00% 0.00% 0.00% NA
Indica Intermediate  786 28.80% 70.90% 0.38% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 82.30% 17.70% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 66.70% 33.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0601227919 G -> A LOC_Os06g03250.1 upstream_gene_variant ; 2829.0bp to feature; MODIFIER silent_mutation Average:40.375; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N
vg0601227919 G -> A LOC_Os06g03240.1 downstream_gene_variant ; 4275.0bp to feature; MODIFIER silent_mutation Average:40.375; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N
vg0601227919 G -> A LOC_Os06g03240-LOC_Os06g03250 intergenic_region ; MODIFIER silent_mutation Average:40.375; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0601227919 NA 3.03E-07 mr1072 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601227919 NA 9.11E-06 mr1137 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601227919 NA 4.46E-10 mr1141 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601227919 NA 2.26E-13 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601227919 NA 1.75E-06 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601227919 NA 3.11E-08 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601227919 7.17E-06 6.26E-08 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601227919 NA 2.35E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251