Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0601213318:

Variant ID: vg0601213318 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 1213318
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.67, T: 0.33, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


CATATTTGCAAACAGAAAACAATTTGTAAATAAAACTTTTATATATGTGTTGTTAGCGATAAAAAGTAAAGGATGAAAAAAAACTACGATGAAAAAACCC[T/C]
AAAATCAACTTCAAATTCAAGATTAAAAATTTAAATTTTAGCTTAAAAATTTAAATTTTAGCTTATAAGCATAAGCATGAGCCAAAAATAGCAGCTTTAT

Reverse complement sequence

ATAAAGCTGCTATTTTTGGCTCATGCTTATGCTTATAAGCTAAAATTTAAATTTTTAAGCTAAAATTTAAATTTTTAATCTTGAATTTGAAGTTGATTTT[A/G]
GGGTTTTTTCATCGTAGTTTTTTTTCATCCTTTACTTTTTATCGCTAACAACACATATATAAAAGTTTTATTTACAAATTGTTTTCTGTTTGCAAATATG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.00% 34.70% 0.17% 4.06% NA
All Indica  2759 42.10% 50.90% 0.18% 6.81% NA
All Japonica  1512 97.80% 2.10% 0.00% 0.13% NA
Aus  269 49.10% 50.20% 0.74% 0.00% NA
Indica I  595 68.20% 31.40% 0.34% 0.00% NA
Indica II  465 68.20% 23.00% 0.00% 8.82% NA
Indica III  913 13.50% 75.70% 0.22% 10.62% NA
Indica Intermediate  786 40.20% 53.30% 0.13% 6.36% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 95.00% 4.60% 0.00% 0.40% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 47.90% 52.10% 0.00% 0.00% NA
Intermediate  90 74.40% 22.20% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0601213318 T -> C LOC_Os06g03200.1 upstream_gene_variant ; 4367.0bp to feature; MODIFIER silent_mutation Average:48.131; most accessible tissue: Minghui63 panicle, score: 94.869 N N N N
vg0601213318 T -> C LOC_Os06g03210.1 downstream_gene_variant ; 2867.0bp to feature; MODIFIER silent_mutation Average:48.131; most accessible tissue: Minghui63 panicle, score: 94.869 N N N N
vg0601213318 T -> C LOC_Os06g03210-LOC_Os06g03220 intergenic_region ; MODIFIER silent_mutation Average:48.131; most accessible tissue: Minghui63 panicle, score: 94.869 N N N N
vg0601213318 T -> DEL N N silent_mutation Average:48.131; most accessible tissue: Minghui63 panicle, score: 94.869 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0601213318 T C -0.05 -0.03 -0.02 -0.04 -0.07 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0601213318 7.19E-06 5.53E-11 mr1063 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601213318 NA 2.19E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601213318 NA 6.95E-06 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601213318 NA 1.35E-09 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601213318 NA 7.83E-07 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251