\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601149832:

Variant ID: vg0601149832 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 1149832
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


CCATAAACTCCACATCATCAAGAAACTAGTACTAGACACTACTCTTCCAATGCAAACACCACTATTCCATATTTTAATTTAATGCTACTTATCTCACATG[G/A]
TGTCTTGGATGTTGTGTAGAAACCATGTCTCATGCAAGACATGGTTTCCTTCTCTTTCCTCATTTATTCACTTGCCACATCATTTTTTGTCCTAGGTGGC

Reverse complement sequence

GCCACCTAGGACAAAAAATGATGTGGCAAGTGAATAAATGAGGAAAGAGAAGGAAACCATGTCTTGCATGAGACATGGTTTCTACACAACATCCAAGACA[C/T]
CATGTGAGATAAGTAGCATTAAATTAAAATATGGAATAGTGGTGTTTGCATTGGAAGAGTAGTGTCTAGTACTAGTTTCTTGATGATGTGGAGTTTATGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.70% 24.80% 0.66% 40.82% NA
All Indica  2759 11.20% 30.50% 0.98% 57.27% NA
All Japonica  1512 79.80% 14.80% 0.07% 5.29% NA
Aus  269 1.90% 29.40% 0.37% 68.40% NA
Indica I  595 3.70% 21.30% 1.34% 73.61% NA
Indica II  465 42.20% 34.60% 0.43% 22.80% NA
Indica III  913 0.90% 31.40% 0.77% 66.92% NA
Indica Intermediate  786 10.70% 34.00% 1.27% 54.07% NA
Temperate Japonica  767 92.60% 0.10% 0.00% 7.30% NA
Tropical Japonica  504 55.60% 42.50% 0.00% 1.98% NA
Japonica Intermediate  241 90.00% 3.70% 0.41% 5.81% NA
VI/Aromatic  96 33.30% 3.10% 1.04% 62.50% NA
Intermediate  90 42.20% 28.90% 1.11% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0601149832 G -> A LOC_Os06g03120.1 upstream_gene_variant ; 3774.0bp to feature; MODIFIER silent_mutation Average:29.273; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0601149832 G -> A LOC_Os06g03110.1 downstream_gene_variant ; 3649.0bp to feature; MODIFIER silent_mutation Average:29.273; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0601149832 G -> A LOC_Os06g03110-LOC_Os06g03120 intergenic_region ; MODIFIER silent_mutation Average:29.273; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0601149832 G -> DEL N N silent_mutation Average:29.273; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0601149832 NA 1.55E-06 mr1377 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601149832 3.39E-07 3.39E-07 mr1377 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601149832 NA 1.35E-09 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601149832 NA 5.58E-07 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601149832 NA 1.52E-06 mr1319_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251