Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601059760:

Variant ID: vg0601059760 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 1059760
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

TCCTTTATCTCCTATTCTTTTTAATATAGTAGCTGACATGCTTACTCTATTGATTAAGAGGGCTAAAGAGGCGGGACTCTTGAATGGGGTTATTCCTCAT[T/C]
TTGTTGATGATGGTTTGTCTATCTTGCAATACGCAAATGATACTATTATCTTCTTGGAACATGACTTGCAACAGGCAAAGAATTTGAAACTGATTTTATC

Reverse complement sequence

GATAAAATCAGTTTCAAATTCTTTGCCTGTTGCAAGTCATGTTCCAAGAAGATAATAGTATCATTTGCGTATTGCAAGATAGACAAACCATCATCAACAA[A/G]
ATGAGGAATAACCCCATTCAAGAGTCCCGCCTCTTTAGCCCTCTTAATCAATAGAGTAAGCATGTCAGCTACTATATTAAAAAGAATAGGAGATAAAGGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.50%	33.60%	6.88%	3.00%	NA
All Indica	2759	79.60%	11.60%	8.81%	0.04%	NA
All Japonica	1512	10.00%	80.80%	0.86%	8.33%	NA
Aus	269	92.60%	1.10%	5.58%	0.74%	NA
Indica I	595	96.60%	2.50%	0.84%	0.00%	NA
Indica II	465	48.80%	44.10%	7.10%	0.00%	NA
Indica III	913	85.30%	0.90%	13.80%	0.00%	NA
Indica Intermediate	786	78.20%	11.60%	10.05%	0.13%	NA
Temperate Japonica	767	0.30%	92.70%	0.00%	7.04%	NA
Tropical Japonica	504	28.00%	56.70%	1.79%	13.49%	NA
Japonica Intermediate	241	3.30%	93.40%	1.66%	1.66%	NA
VI/Aromatic	96	38.50%	4.20%	45.83%	11.46%	NA
Intermediate	90	41.10%	45.60%	11.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0601059760	T -> C	LOC_Os06g02880.1	missense_variant ; p.Phe711Leu; MODERATE	nonsynonymous_codon ; F711L	Average:25.634; most accessible tissue: Minghui63 root, score: 41.911	unknown	unknown	TOLERATED	1.00
vg0601059760	T -> DEL	LOC_Os06g02880.1	N	frameshift_variant	Average:25.634; most accessible tissue: Minghui63 root, score: 41.911	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0601059760	NA	1.59E-11	mr1069	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601059760	NA	1.95E-43	mr1141	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601059760	NA	6.77E-18	mr1141	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601059760	NA	5.47E-17	mr1143	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601059760	NA	3.18E-13	mr1149	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601059760	NA	2.11E-15	mr1167	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601059760	NA	1.28E-07	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601059760	NA	1.08E-11	mr1277	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601059760	NA	4.01E-10	mr1282	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601059760	NA	9.32E-17	mr1308	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601059760	NA	2.45E-09	mr1399	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601059760	NA	3.67E-13	mr1441	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601059760	NA	1.19E-06	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601059760	NA	1.95E-14	mr1535	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601059760	NA	1.12E-09	mr1658	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601059760	NA	5.05E-15	mr1675	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601059760	NA	2.99E-15	mr1726	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601059760	NA	2.90E-25	mr1805	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601059760	NA	1.39E-15	mr1969	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601059760	NA	5.53E-18	mr1995	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601059760	4.93E-07	NA	mr1039_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601059760	NA	1.10E-18	mr1141_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601059760	NA	3.66E-07	mr1149_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601059760	NA	1.06E-15	mr1277_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601059760	NA	3.96E-10	mr1399_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601059760	NA	1.67E-07	mr1441_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601059760	NA	1.22E-07	mr1654_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601059760	NA	1.45E-06	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601059760	NA	1.99E-42	mr1805_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601059760	NA	1.17E-07	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251