\
| Variant ID: vg0601001133 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 1001133 |
| Reference Allele: T | Alternative Allele: A,C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AGATGTTAGCCGACTGAAGGTTAGATAACAATATTGCCGAAGATTATATAGAATATATGATAACTCGACAACTTACAGAGACAAGATTAGAGTATCATAA[T/A,C]
GATGGAAGCACTAATCCCGAGAACGCAAGCCGCCATAACAAGTCGTACCTCTAGTTGAAGATCGAAACCGATGCAGCTCAACCCGAAAGCAAGAACTAGT
ACTAGTTCTTGCTTTCGGGTTGAGCTGCATCGGTTTCGATCTTCAACTAGAGGTACGACTTGTTATGGCGGCTTGCGTTCTCGGGATTAGTGCTTCCATC[A/T,G]
TTATGATACTCTAATCTTGTCTCTGTAAGTTGTCGAGTTATCATATATTCTATATAATCTTCGGCAATATTGTTATCTAACCTTCAGTCGGCTAACATCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.60% | 6.90% | 6.26% | 7.19% | A: 0.06% |
| All Indica | 2759 | 70.40% | 11.20% | 8.66% | 9.68% | A: 0.07% |
| All Japonica | 1512 | 96.20% | 0.30% | 1.39% | 2.05% | NA |
| Aus | 269 | 86.60% | 3.00% | 7.43% | 2.97% | NA |
| Indica I | 595 | 82.00% | 1.30% | 3.19% | 13.45% | NA |
| Indica II | 465 | 77.20% | 7.50% | 7.10% | 7.96% | A: 0.22% |
| Indica III | 913 | 59.00% | 17.60% | 14.02% | 9.20% | A: 0.11% |
| Indica Intermediate | 786 | 70.90% | 13.20% | 7.51% | 8.40% | NA |
| Temperate Japonica | 767 | 97.80% | 0.10% | 0.78% | 1.30% | NA |
| Tropical Japonica | 504 | 93.50% | 0.80% | 2.18% | 3.57% | NA |
| Japonica Intermediate | 241 | 97.10% | 0.00% | 1.66% | 1.24% | NA |
| VI/Aromatic | 96 | 55.20% | 3.10% | 9.38% | 31.25% | A: 1.04% |
| Intermediate | 90 | 84.40% | 3.30% | 7.78% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0601001133 | T -> C | LOC_Os06g02760.1 | downstream_gene_variant ; 2410.0bp to feature; MODIFIER | silent_mutation | Average:34.222; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg0601001133 | T -> C | LOC_Os06g02750.1 | intron_variant ; MODIFIER | silent_mutation | Average:34.222; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg0601001133 | T -> A | LOC_Os06g02760.1 | downstream_gene_variant ; 2410.0bp to feature; MODIFIER | silent_mutation | Average:34.222; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg0601001133 | T -> A | LOC_Os06g02750.1 | intron_variant ; MODIFIER | silent_mutation | Average:34.222; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg0601001133 | T -> DEL | N | N | silent_mutation | Average:34.222; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0601001133 | 6.96E-08 | 6.96E-08 | mr1300 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601001133 | 5.76E-06 | 7.88E-06 | mr1554 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601001133 | 5.62E-06 | 3.38E-06 | mr1758 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601001133 | 1.95E-07 | 2.38E-08 | mr1841 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601001133 | 7.55E-06 | 7.55E-06 | mr1926 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |