\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601001133:

Variant ID: vg0601001133 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 1001133
Reference Allele: TAlternative Allele: A,C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGATGTTAGCCGACTGAAGGTTAGATAACAATATTGCCGAAGATTATATAGAATATATGATAACTCGACAACTTACAGAGACAAGATTAGAGTATCATAA[T/A,C]
GATGGAAGCACTAATCCCGAGAACGCAAGCCGCCATAACAAGTCGTACCTCTAGTTGAAGATCGAAACCGATGCAGCTCAACCCGAAAGCAAGAACTAGT

Reverse complement sequence

ACTAGTTCTTGCTTTCGGGTTGAGCTGCATCGGTTTCGATCTTCAACTAGAGGTACGACTTGTTATGGCGGCTTGCGTTCTCGGGATTAGTGCTTCCATC[A/T,G]
TTATGATACTCTAATCTTGTCTCTGTAAGTTGTCGAGTTATCATATATTCTATATAATCTTCGGCAATATTGTTATCTAACCTTCAGTCGGCTAACATCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.60% 6.90% 6.26% 7.19% A: 0.06%
All Indica  2759 70.40% 11.20% 8.66% 9.68% A: 0.07%
All Japonica  1512 96.20% 0.30% 1.39% 2.05% NA
Aus  269 86.60% 3.00% 7.43% 2.97% NA
Indica I  595 82.00% 1.30% 3.19% 13.45% NA
Indica II  465 77.20% 7.50% 7.10% 7.96% A: 0.22%
Indica III  913 59.00% 17.60% 14.02% 9.20% A: 0.11%
Indica Intermediate  786 70.90% 13.20% 7.51% 8.40% NA
Temperate Japonica  767 97.80% 0.10% 0.78% 1.30% NA
Tropical Japonica  504 93.50% 0.80% 2.18% 3.57% NA
Japonica Intermediate  241 97.10% 0.00% 1.66% 1.24% NA
VI/Aromatic  96 55.20% 3.10% 9.38% 31.25% A: 1.04%
Intermediate  90 84.40% 3.30% 7.78% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0601001133 T -> C LOC_Os06g02760.1 downstream_gene_variant ; 2410.0bp to feature; MODIFIER silent_mutation Average:34.222; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0601001133 T -> C LOC_Os06g02750.1 intron_variant ; MODIFIER silent_mutation Average:34.222; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0601001133 T -> A LOC_Os06g02760.1 downstream_gene_variant ; 2410.0bp to feature; MODIFIER silent_mutation Average:34.222; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0601001133 T -> A LOC_Os06g02750.1 intron_variant ; MODIFIER silent_mutation Average:34.222; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0601001133 T -> DEL N N silent_mutation Average:34.222; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0601001133 6.96E-08 6.96E-08 mr1300 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601001133 5.76E-06 7.88E-06 mr1554 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601001133 5.62E-06 3.38E-06 mr1758 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601001133 1.95E-07 2.38E-08 mr1841 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601001133 7.55E-06 7.55E-06 mr1926 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251