\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601000809:

Variant ID: vg0601000809 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 1000809
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAAAGCTTAATACACCTAAATGCAATAGGATCTTAACATAAAGGGCGGATCTAGCATATCAATTAAGCATATAAAACATAAAGCTAAATCAGGTAAGAT[T/C]
GGCTGAAACTCCGATGCTACCCTAATCGGAAACCAAGAAGCAGGCTAGAGATTATAGTTCTAAGCACGACTTATGAGGTCAAACCTAACTGATGCAGCCA

Reverse complement sequence

TGGCTGCATCAGTTAGGTTTGACCTCATAAGTCGTGCTTAGAACTATAATCTCTAGCCTGCTTCTTGGTTTCCGATTAGGGTAGCATCGGAGTTTCAGCC[A/G]
ATCTTACCTGATTTAGCTTTATGTTTTATATGCTTAATTGATATGCTAGATCCGCCCTTTATGTTAAGATCCTATTGCATTTAGGTGTATTAAGCTTTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.90% 36.80% 8.68% 5.59% NA
All Indica  2759 68.20% 15.30% 10.91% 5.55% NA
All Japonica  1512 16.70% 81.30% 1.06% 0.86% NA
Aus  269 51.70% 10.40% 26.77% 11.15% NA
Indica I  595 91.40% 6.70% 1.51% 0.34% NA
Indica II  465 43.00% 51.00% 5.16% 0.86% NA
Indica III  913 66.00% 1.20% 20.04% 12.71% NA
Indica Intermediate  786 68.10% 17.20% 10.81% 3.94% NA
Temperate Japonica  767 0.90% 96.60% 1.43% 1.04% NA
Tropical Japonica  504 46.80% 52.40% 0.60% 0.20% NA
Japonica Intermediate  241 4.10% 93.40% 0.83% 1.66% NA
VI/Aromatic  96 5.20% 14.60% 14.58% 65.62% NA
Intermediate  90 36.70% 50.00% 7.78% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0601000809 T -> C LOC_Os06g02760.1 downstream_gene_variant ; 2734.0bp to feature; MODIFIER silent_mutation Average:42.802; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0601000809 T -> C LOC_Os06g02750.1 intron_variant ; MODIFIER silent_mutation Average:42.802; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0601000809 T -> DEL N N silent_mutation Average:42.802; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0601000809 NA 2.83E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809 NA 1.46E-13 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809 NA 5.82E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809 NA 1.44E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809 NA 5.65E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809 NA 1.90E-07 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809 NA 1.12E-13 mr1141 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809 NA 9.89E-16 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809 NA 4.59E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809 NA 2.30E-13 mr1277 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809 NA 7.36E-15 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809 NA 2.13E-07 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809 NA 3.58E-24 mr1805 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809 NA 6.84E-06 mr1955 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809 NA 6.42E-08 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809 NA 7.27E-08 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809 NA 2.59E-24 mr1077_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809 NA 1.54E-09 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809 NA 2.99E-15 mr1141_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809 NA 8.16E-27 mr1149_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809 NA 4.63E-09 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809 NA 1.29E-27 mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809 NA 1.86E-09 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809 NA 1.80E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809 NA 8.93E-41 mr1805_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251