Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601000809:

Variant ID: vg0601000809 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 1000809
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAAAGCTTAATACACCTAAATGCAATAGGATCTTAACATAAAGGGCGGATCTAGCATATCAATTAAGCATATAAAACATAAAGCTAAATCAGGTAAGAT[T/C]
GGCTGAAACTCCGATGCTACCCTAATCGGAAACCAAGAAGCAGGCTAGAGATTATAGTTCTAAGCACGACTTATGAGGTCAAACCTAACTGATGCAGCCA

Reverse complement sequence

TGGCTGCATCAGTTAGGTTTGACCTCATAAGTCGTGCTTAGAACTATAATCTCTAGCCTGCTTCTTGGTTTCCGATTAGGGTAGCATCGGAGTTTCAGCC[A/G]
ATCTTACCTGATTTAGCTTTATGTTTTATATGCTTAATTGATATGCTAGATCCGCCCTTTATGTTAAGATCCTATTGCATTTAGGTGTATTAAGCTTTAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.90%	36.80%	8.68%	5.59%	NA
All Indica	2759	68.20%	15.30%	10.91%	5.55%	NA
All Japonica	1512	16.70%	81.30%	1.06%	0.86%	NA
Aus	269	51.70%	10.40%	26.77%	11.15%	NA
Indica I	595	91.40%	6.70%	1.51%	0.34%	NA
Indica II	465	43.00%	51.00%	5.16%	0.86%	NA
Indica III	913	66.00%	1.20%	20.04%	12.71%	NA
Indica Intermediate	786	68.10%	17.20%	10.81%	3.94%	NA
Temperate Japonica	767	0.90%	96.60%	1.43%	1.04%	NA
Tropical Japonica	504	46.80%	52.40%	0.60%	0.20%	NA
Japonica Intermediate	241	4.10%	93.40%	0.83%	1.66%	NA
VI/Aromatic	96	5.20%	14.60%	14.58%	65.62%	NA
Intermediate	90	36.70%	50.00%	7.78%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0601000809	T -> C	LOC_Os06g02760.1	downstream_gene_variant ; 2734.0bp to feature; MODIFIER	silent_mutation	Average:42.802; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0601000809	T -> C	LOC_Os06g02750.1	intron_variant ; MODIFIER	silent_mutation	Average:42.802; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0601000809	T -> DEL	N	N	silent_mutation	Average:42.802; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0601000809	NA	2.83E-06	mr1044	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809	NA	1.46E-13	mr1069	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809	NA	5.82E-06	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809	NA	1.44E-06	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809	NA	5.65E-06	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809	NA	1.90E-07	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809	NA	1.12E-13	mr1141	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809	NA	9.89E-16	mr1149	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809	NA	4.59E-07	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809	NA	2.30E-13	mr1277	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809	NA	7.36E-15	mr1441	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809	NA	2.13E-07	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809	NA	3.58E-24	mr1805	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809	NA	6.84E-06	mr1955	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809	NA	6.42E-08	mr1072_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809	NA	7.27E-08	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809	NA	2.59E-24	mr1077_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809	NA	1.54E-09	mr1077_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809	NA	2.99E-15	mr1141_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809	NA	8.16E-27	mr1149_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809	NA	4.63E-09	mr1149_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809	NA	1.29E-27	mr1441_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809	NA	1.86E-09	mr1441_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809	NA	1.80E-07	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601000809	NA	8.93E-41	mr1805_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251