Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0600926009:

Variant ID: vg0600926009 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 926009
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


CCTCCCCTCCCGGTGCACCGCGCCGAACAGAAACGTCGGCACTGCGGCGGAGGCGGCGGCGCCGGCGAGGGGGTGAGCGGCGCGACGAGCGTGTAGCCCA[C/T]
CCGGTTGTAGGCGTCGTCGGTGAAGCGGTTGACGACGACGGCGCCGCCGCCGCACGCCGCCTGCTCGATGGCGCGCAGGGCGGCGGCGTTGCGGCTCTCG

Reverse complement sequence

CGAGAGCCGCAACGCCGCCGCCCTGCGCGCCATCGAGCAGGCGGCGTGCGGCGGCGGCGCCGTCGTCGTCAACCGCTTCACCGACGACGCCTACAACCGG[G/A]
TGGGCTACACGCTCGTCGCGCCGCTCACCCCCTCGCCGGCGCCGCCGCCTCCGCCGCAGTGCCGACGTTTCTGTTCGGCGCGGTGCACCGGGAGGGGAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.90% 19.90% 6.43% 1.78% NA
All Indica  2759 66.00% 24.80% 6.56% 2.61% NA
All Japonica  1512 84.20% 15.50% 0.26% 0.07% NA
Aus  269 71.70% 1.50% 24.91% 1.86% NA
Indica I  595 26.40% 66.20% 5.21% 2.18% NA
Indica II  465 78.70% 16.80% 3.87% 0.65% NA
Indica III  913 87.00% 1.90% 8.21% 2.96% NA
Indica Intermediate  786 64.20% 24.80% 7.25% 3.69% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 54.60% 45.00% 0.40% 0.00% NA
Japonica Intermediate  241 96.30% 2.90% 0.83% 0.00% NA
VI/Aromatic  96 46.90% 0.00% 46.88% 6.25% NA
Intermediate  90 71.10% 21.10% 7.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0600926009 C -> T LOC_Os06g02610.1 splice_donor_variant&intron_variant ; HIGH splice_donor_variant Average:88.79; most accessible tissue: Zhenshan97 flag leaf, score: 96.266 N N N N
vg0600926009 C -> DEL LOC_Os06g02610.1 N splice_donor_variant Average:88.79; most accessible tissue: Zhenshan97 flag leaf, score: 96.266 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0600926009 C T -0.01 -0.01 -0.01 -0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0600926009 NA 4.69E-06 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0600926009 NA 3.02E-08 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600926009 NA 5.06E-06 mr1807 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600926009 NA 3.24E-06 mr1955 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600926009 NA 7.57E-07 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600926009 1.11E-06 5.69E-07 mr1715_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600926009 NA 7.97E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600926009 NA 5.78E-07 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251