Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0600848094:

Variant ID: vg0600848094 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 848094
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CACTCCATTGGTAAAATCTAAATGGTTTTTCTTAAATTATTGCGCAAAGTGTTTGGTTCGTTGGTTCGTAAACTCATCCGTATATATTATTTCGATTTCC[G/A]
AACTCTTAAAATACATTTTCAGATCTACGAACATGATAAAATGTGTCATTCCGGTCCGAGGTTGCCATGATCCTTCTAAGATTCTACGTGACACTTATGT

Reverse complement sequence

ACATAAGTGTCACGTAGAATCTTAGAAGGATCATGGCAACCTCGGACCGGAATGACACATTTTATCATGTTCGTAGATCTGAAAATGTATTTTAAGAGTT[C/T]
GGAAATCGAAATAATATATACGGATGAGTTTACGAACCAACGAACCAAACACTTTGCGCAATAATTTAAGAAAAACCATTTAGATTTTACCAATGGAGTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.90%	28.00%	0.08%	0.00%	NA
All Indica	2759	65.90%	34.00%	0.14%	0.00%	NA
All Japonica	1512	90.10%	9.90%	0.00%	0.00%	NA
Aus	269	21.20%	78.80%	0.00%	0.00%	NA
Indica I	595	75.00%	24.90%	0.17%	0.00%	NA
Indica II	465	81.50%	18.50%	0.00%	0.00%	NA
Indica III	913	55.20%	44.80%	0.00%	0.00%	NA
Indica Intermediate	786	62.10%	37.50%	0.38%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	72.40%	27.60%	0.00%	0.00%	NA
Japonica Intermediate	241	96.70%	3.30%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	78.90%	21.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0600848094	G -> A	LOC_Os06g02440.1	upstream_gene_variant ; 3909.0bp to feature; MODIFIER	silent_mutation	Average:44.113; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg0600848094	G -> A	LOC_Os06g02450.1	upstream_gene_variant ; 961.0bp to feature; MODIFIER	silent_mutation	Average:44.113; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg0600848094	G -> A	LOC_Os06g02460.1	upstream_gene_variant ; 2803.0bp to feature; MODIFIER	silent_mutation	Average:44.113; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg0600848094	G -> A	LOC_Os06g02450-LOC_Os06g02460	intergenic_region ; MODIFIER	silent_mutation	Average:44.113; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0600848094	5.22E-06	1.27E-08	mr1349	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600848094	NA	2.72E-06	mr1457	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600848094	NA	4.94E-10	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600848094	NA	6.07E-09	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600848094	NA	1.90E-07	mr1457_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600848094	NA	4.44E-11	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600848094	NA	3.15E-06	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600848094	NA	3.84E-06	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251