Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0600807366:

Variant ID: vg0600807366 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 807366
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, G: 0.10, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


AGAGCAGGTACAATAGAAGGCTATAAACTAGCTGTAAACATATTTTAAAAAGATAAAAGAAGATAGAGAAAAGCAGCAGACTATAGATTTGTAGCCAGCT[A/G]
CAGCACGGACTCCAAAACGTAATGTGCGTATGGTAGGTGGGACCAGATATTAATAGTATAGTAAACAAATATTATATGAATTGGCTATTAAATTGACTAT

Reverse complement sequence

ATAGTCAATTTAATAGCCAATTCATATAATATTTGTTTACTATACTATTAATATCTGGTCCCACCTACCATACGCACATTACGTTTTGGAGTCCGTGCTG[T/C]
AGCTGGCTACAAATCTATAGTCTGCTGCTTTTCTCTATCTTCTTTTATCTTTTTAAAATATGTTTACAGCTAGTTTATAGCCTTCTATTGTACCTGCTCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.30% 9.80% 0.02% 0.85% NA
All Indica  2759 83.80% 16.20% 0.04% 0.00% NA
All Japonica  1512 96.90% 0.50% 0.00% 2.65% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 67.70% 32.30% 0.00% 0.00% NA
Indica III  913 79.30% 20.70% 0.00% 0.00% NA
Indica Intermediate  786 86.40% 13.50% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 90.90% 1.20% 0.00% 7.94% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0600807366 A -> G LOC_Os06g02380.1 downstream_gene_variant ; 3668.0bp to feature; MODIFIER silent_mutation Average:61.706; most accessible tissue: Zhenshan97 panicle, score: 86.788 N N N N
vg0600807366 A -> G LOC_Os06g02380.2 downstream_gene_variant ; 3668.0bp to feature; MODIFIER silent_mutation Average:61.706; most accessible tissue: Zhenshan97 panicle, score: 86.788 N N N N
vg0600807366 A -> G LOC_Os06g02370-LOC_Os06g02380 intergenic_region ; MODIFIER silent_mutation Average:61.706; most accessible tissue: Zhenshan97 panicle, score: 86.788 N N N N
vg0600807366 A -> DEL N N silent_mutation Average:61.706; most accessible tissue: Zhenshan97 panicle, score: 86.788 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0600807366 A G 0.01 0.01 0.01 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0600807366 NA 2.45E-07 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600807366 NA 9.65E-08 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600807366 NA 1.40E-06 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600807366 NA 8.29E-07 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600807366 NA 4.38E-06 mr1892 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600807366 NA 6.82E-07 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600807366 NA 2.59E-10 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600807366 NA 4.82E-10 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600807366 NA 8.07E-14 mr1077_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600807366 NA 6.18E-10 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600807366 NA 5.59E-06 mr1399_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600807366 NA 3.03E-10 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600807366 NA 6.33E-08 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600807366 NA 2.74E-09 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600807366 NA 4.10E-08 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600807366 NA 5.40E-06 mr1892_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251