\
| Variant ID: vg0600805043 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 805043 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.11, others allele: 0.00, population size: 236. )
ACACCATTTTCACTTCACAGGTGTCACATATTGGCATTTGCGTTTTGAGGCGGCAATTGCAATTTGCAAATGACAGAATCATTGCACACGCACATTATTA[G/A]
TTGGGGGATAATCTACAACTACATTCATTTGTTGGTGGGATATGTCTAATGCACTACTGATTCAAAAATCATGGCTGGTAAAATAGTATATCTTGGGGTA
TACCCCAAGATATACTATTTTACCAGCCATGATTTTTGAATCAGTAGTGCATTAGACATATCCCACCAACAAATGAATGTAGTTGTAGATTATCCCCCAA[C/T]
TAATAATGTGCGTGTGCAATGATTCTGTCATTTGCAAATTGCAATTGCCGCCTCAAAACGCAAATGCCAATATGTGACACCTGTGAAGTGAAAATGGTGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.20% | 47.70% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 75.20% | 24.60% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 11.70% | 88.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 65.80% | 33.80% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.00% | 0.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 48.60% | 51.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 72.30% | 27.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 76.50% | 23.20% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 0.30% | 99.60% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 32.50% | 67.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 4.60% | 95.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 35.60% | 64.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0600805043 | G -> A | LOC_Os06g02370.1 | upstream_gene_variant ; 4231.0bp to feature; MODIFIER | silent_mutation | Average:72.409; most accessible tissue: Callus, score: 93.167 | N | N | N | N |
| vg0600805043 | G -> A | LOC_Os06g02370.3 | upstream_gene_variant ; 4231.0bp to feature; MODIFIER | silent_mutation | Average:72.409; most accessible tissue: Callus, score: 93.167 | N | N | N | N |
| vg0600805043 | G -> A | LOC_Os06g02370-LOC_Os06g02380 | intergenic_region ; MODIFIER | silent_mutation | Average:72.409; most accessible tissue: Callus, score: 93.167 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0600805043 | NA | 8.74E-07 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 4.58E-19 | mr1077 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 2.97E-07 | mr1077 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 2.01E-12 | mr1141 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 1.55E-13 | mr1149 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 5.96E-06 | mr1149 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 1.19E-07 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 6.35E-11 | mr1277 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 1.19E-14 | mr1441 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 3.61E-09 | mr1441 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 4.25E-07 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | 8.48E-06 | 8.47E-06 | mr1562 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 1.64E-06 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 2.03E-08 | mr1072_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 3.38E-09 | mr1075_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 6.73E-30 | mr1077_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 4.05E-12 | mr1077_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 1.09E-14 | mr1141_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 2.18E-30 | mr1149_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 1.28E-10 | mr1149_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 2.81E-07 | mr1183_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 9.34E-07 | mr1402_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 2.55E-31 | mr1441_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 1.69E-11 | mr1441_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 1.38E-08 | mr1482_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 8.53E-06 | mr1521_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 6.21E-09 | mr1557_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 4.66E-18 | mr1592_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 7.26E-07 | mr1592_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 2.12E-06 | mr1609_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 2.65E-07 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 3.78E-07 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 4.44E-06 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 1.02E-14 | mr1790_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 2.44E-08 | mr1805_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 2.53E-08 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 6.44E-11 | mr1844_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600805043 | NA | 9.76E-07 | mr1915_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |