\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0600576478:

Variant ID: vg0600576478 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 576478
Reference Allele: CAlternative Allele: T,CCAATGCCAGATCTGACGGCCCCGAGGTCCA
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


GTGTGAATGGATCCGGCCTTCCTTATGACGGATCCAGGCCACACCAGGCCGCAACCCTCCTCTTCGCACTCGTCGCCAAGCCATCTGCCATCGGGGCCTA[C/T,CCAATGCCAGATCTGACGGCCCCGAGGTCCA]
TGTAACGATCCGCCTCTCCCAGGCCGGGTCCACTTACATCTGGCAGCTTTCATAGGTCATAGACTGCCCTCATAGACTAACACATGTCTTTTCTGCACAC

Reverse complement sequence

GTGTGCAGAAAAGACATGTGTTAGTCTATGAGGGCAGTCTATGACCTATGAAAGCTGCCAGATGTAAGTGGACCCGGCCTGGGAGAGGCGGATCGTTACA[G/A,TGGACCTCGGGGCCGTCAGATCTGGCATTGG]
TAGGCCCCGATGGCAGATGGCTTGGCGACGAGTGCGAAGAGGAGGGTTGCGGCCTGGTGTGGCCTGGATCCGTCATAAGGAAGGCCGGATCCATTCACAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.60% 21.10% 0.25% 0.00% CCAATGCCAGATCTGACGGCCCCGAGGTCCA: 0.02%
All Indica  2759 64.00% 35.80% 0.22% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 96.70% 0.70% 2.23% 0.00% CCAATGCCAGATCTGACGGCCCCGAGGTCCA: 0.37%
Indica I  595 46.40% 53.30% 0.34% 0.00% NA
Indica II  465 55.30% 44.70% 0.00% 0.00% NA
Indica III  913 80.90% 19.10% 0.00% 0.00% NA
Indica Intermediate  786 62.80% 36.60% 0.51% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0600576478 C -> CCAATGCCAGATCTGACGGCCCCGAGGTCC A LOC_Os06g02010.1 upstream_gene_variant ; 2157.0bp to feature; MODIFIER silent_mutation Average:51.196; most accessible tissue: Minghui63 young leaf, score: 87.057 N N N N
vg0600576478 C -> CCAATGCCAGATCTGACGGCCCCGAGGTCC A LOC_Os06g02019.1 upstream_gene_variant ; 4186.0bp to feature; MODIFIER silent_mutation Average:51.196; most accessible tissue: Minghui63 young leaf, score: 87.057 N N N N
vg0600576478 C -> CCAATGCCAGATCTGACGGCCCCGAGGTCC A LOC_Os06g02010-LOC_Os06g02019 intergenic_region ; MODIFIER silent_mutation Average:51.196; most accessible tissue: Minghui63 young leaf, score: 87.057 N N N N
vg0600576478 C -> T LOC_Os06g02010.1 upstream_gene_variant ; 2156.0bp to feature; MODIFIER silent_mutation Average:51.196; most accessible tissue: Minghui63 young leaf, score: 87.057 N N N N
vg0600576478 C -> T LOC_Os06g02019.1 upstream_gene_variant ; 4187.0bp to feature; MODIFIER silent_mutation Average:51.196; most accessible tissue: Minghui63 young leaf, score: 87.057 N N N N
vg0600576478 C -> T LOC_Os06g02010-LOC_Os06g02019 intergenic_region ; MODIFIER silent_mutation Average:51.196; most accessible tissue: Minghui63 young leaf, score: 87.057 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0600576478 C CCAAT* -0.06 -0.05 -0.01 -0.07 -0.04 -0.04
vg0600576478 C T -0.02 -0.03 -0.03 -0.03 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0600576478 NA 7.03E-06 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600576478 9.49E-06 NA mr1063 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600576478 NA 3.08E-07 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600576478 3.18E-06 NA mr1183 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600576478 NA 1.79E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600576478 2.18E-06 NA mr1503 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600576478 NA 5.60E-06 mr1691 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600576478 NA 1.29E-08 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600576478 NA 7.68E-09 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600576478 NA 2.70E-07 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600576478 NA 5.16E-08 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600576478 NA 1.27E-08 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600576478 NA 3.54E-11 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251