Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0600570367:

Variant ID: vg0600570367 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 570367
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

GCACGGGTGTGGGTATGGGGACAATTTTGTACCCGCGATGGGTGTGGGTATTTAAGTGGGAGTATTTAGATATGGTGGGTGTGGGTATGGGGCAAGAGAA[C/T]
CCGATGGGTATGCATACTTCTAATAGAGACAGGGGTAGATTTGTTGGGCCAGTATTTCCAGGCCCATTAATTCGTATACCACCTTTAGAGTTCAGACTAC

Reverse complement sequence

GTAGTCTGAACTCTAAAGGTGGTATACGAATTAATGGGCCTGGAAATACTGGCCCAACAAATCTACCCCTGTCTCTATTAGAAGTATGCATACCCATCGG[G/A]
TTCTCTTGCCCCATACCCACACCCACCATATCTAAATACTCCCACTTAAATACCCACACCCATCGCGGGTACAAAATTGTCCCCATACCCACACCCGTGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.50%	21.00%	0.49%	0.00%	NA
All Indica	2759	64.00%	35.50%	0.47%	0.00%	NA
All Japonica	1512	99.30%	0.10%	0.66%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	46.20%	53.10%	0.67%	0.00%	NA
Indica II	465	54.60%	44.70%	0.65%	0.00%	NA
Indica III	913	81.10%	18.80%	0.11%	0.00%	NA
Indica Intermediate	786	63.20%	36.10%	0.64%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	98.00%	0.00%	1.98%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0600570367	C -> T	LOC_Os06g02000.1	downstream_gene_variant ; 2682.0bp to feature; MODIFIER	silent_mutation	Average:75.387; most accessible tissue: Minghui63 young leaf, score: 91.71	N	N	N	N
vg0600570367	C -> T	LOC_Os06g02010.1	downstream_gene_variant ; 3596.0bp to feature; MODIFIER	silent_mutation	Average:75.387; most accessible tissue: Minghui63 young leaf, score: 91.71	N	N	N	N
vg0600570367	C -> T	LOC_Os06g02000.2	downstream_gene_variant ; 2709.0bp to feature; MODIFIER	silent_mutation	Average:75.387; most accessible tissue: Minghui63 young leaf, score: 91.71	N	N	N	N
vg0600570367	C -> T	LOC_Os06g02000.3	downstream_gene_variant ; 2709.0bp to feature; MODIFIER	silent_mutation	Average:75.387; most accessible tissue: Minghui63 young leaf, score: 91.71	N	N	N	N
vg0600570367	C -> T	LOC_Os06g02000-LOC_Os06g02010	intergenic_region ; MODIFIER	silent_mutation	Average:75.387; most accessible tissue: Minghui63 young leaf, score: 91.71	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0600570367	C	T	-0.05	-0.01	-0.02	-0.07	-0.05	-0.06

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0600570367	NA	3.14E-06	mr1011	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600570367	3.86E-06	NA	mr1063	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600570367	9.03E-06	6.14E-08	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600570367	NA	7.52E-11	mr1352	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600570367	NA	1.85E-06	mr1691	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600570367	NA	1.28E-06	mr1693	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600570367	NA	9.47E-11	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600570367	7.06E-06	1.55E-11	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600570367	NA	3.46E-06	mr1728	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600570367	NA	6.03E-11	mr1751	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600570367	NA	2.49E-08	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600570367	NA	7.13E-06	mr1968	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600570367	NA	7.43E-09	mr1220_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600570367	NA	3.46E-06	mr1691_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600570367	NA	8.02E-11	mr1707_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600570367	NA	8.29E-14	mr1728_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251