Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0600459723:

Variant ID: vg0600459723 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 459723
Reference Allele: G	Alternative Allele: T,A
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAACTGAGAGATGACCGGGACAGTGAGGGCGCCACATATGTCACCAACCCAGGAGTTGTTCGCTAACCCAACGGCAACCGTGCGCGATCCCCGAAAGCGT[G/T,A]
GAGGCACGGCGTGGAGGAGGTCAGGAGCTATAGAAGCTATCGAGCGACCATCGATCCATCGGTCAGTCCAGAAGAGCGTGGACTGACCATCTCCCAGGAT

Reverse complement sequence

ATCCTGGGAGATGGTCAGTCCACGCTCTTCTGGACTGACCGATGGATCGATGGTCGCTCGATAGCTTCTATAGCTCCTGACCTCCTCCACGCCGTGCCTC[C/A,T]
ACGCTTTCGGGGATCGCGCACGGTTGCCGTTGGGTTAGCGAACAACTCCTGGGTTGGTGACATATGTGGCGCCCTCACTGTCCCGGTCATCTCTCAGTTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.10%	30.50%	0.47%	0.72%	A: 0.21%
All Indica	2759	47.90%	50.40%	0.40%	1.16%	A: 0.14%
All Japonica	1512	96.90%	2.10%	0.66%	0.13%	A: 0.26%
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	39.00%	58.50%	0.84%	1.68%	NA
Indica II	465	80.60%	18.30%	0.22%	0.43%	A: 0.43%
Indica III	913	32.40%	66.20%	0.44%	0.99%	NA
Indica Intermediate	786	53.20%	45.00%	0.13%	1.40%	A: 0.25%
Temperate Japonica	767	99.70%	0.00%	0.00%	0.26%	NA
Tropical Japonica	504	91.50%	5.80%	1.98%	0.00%	A: 0.79%
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	1.00%	1.04%	0.00%	NA
Intermediate	90	83.30%	14.40%	0.00%	0.00%	A: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0600459723	G -> T	LOC_Os06g01790.1	downstream_gene_variant ; 2143.0bp to feature; MODIFIER	silent_mutation	Average:65.162; most accessible tissue: Minghui63 young leaf, score: 80.234	N	N	N	N
vg0600459723	G -> T	LOC_Os06g01800.1	downstream_gene_variant ; 1414.0bp to feature; MODIFIER	silent_mutation	Average:65.162; most accessible tissue: Minghui63 young leaf, score: 80.234	N	N	N	N
vg0600459723	G -> T	LOC_Os06g01790-LOC_Os06g01800	intergenic_region ; MODIFIER	silent_mutation	Average:65.162; most accessible tissue: Minghui63 young leaf, score: 80.234	N	N	N	N
vg0600459723	G -> A	LOC_Os06g01790.1	downstream_gene_variant ; 2143.0bp to feature; MODIFIER	silent_mutation	Average:65.162; most accessible tissue: Minghui63 young leaf, score: 80.234	N	N	N	N
vg0600459723	G -> A	LOC_Os06g01800.1	downstream_gene_variant ; 1414.0bp to feature; MODIFIER	silent_mutation	Average:65.162; most accessible tissue: Minghui63 young leaf, score: 80.234	N	N	N	N
vg0600459723	G -> A	LOC_Os06g01790-LOC_Os06g01800	intergenic_region ; MODIFIER	silent_mutation	Average:65.162; most accessible tissue: Minghui63 young leaf, score: 80.234	N	N	N	N
vg0600459723	G -> DEL	N	N	silent_mutation	Average:65.162; most accessible tissue: Minghui63 young leaf, score: 80.234	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0600459723	NA	2.16E-18	Plant_height	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0600459723	NA	2.88E-14	mr1032	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600459723	NA	3.65E-06	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600459723	NA	5.20E-06	mr1165	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600459723	NA	9.24E-14	mr1478	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600459723	NA	8.09E-06	mr1478	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600459723	NA	9.56E-07	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600459723	NA	4.80E-07	mr1739	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600459723	NA	3.67E-06	mr1002_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600459723	NA	8.44E-06	mr1060_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600459723	NA	7.45E-06	mr1060_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600459723	NA	3.52E-06	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600459723	NA	1.29E-06	mr1165_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600459723	NA	7.24E-08	mr1183_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600459723	NA	5.59E-07	mr1268_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600459723	NA	3.05E-08	mr1268_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600459723	NA	1.58E-08	mr1327_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600459723	NA	3.10E-07	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600459723	NA	1.06E-06	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600459723	NA	1.14E-12	mr1478_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600459723	NA	5.17E-09	mr1478_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600459723	NA	5.90E-10	mr1627_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600459723	NA	4.23E-22	mr1971_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600459723	NA	3.84E-10	mr1971_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251