\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0600457865:

Variant ID: vg0600457865 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 457865
Reference Allele: TAlternative Allele: C,TCTCTCGAC
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACGGTGGCCGCTTGGGGTCGTCCAAAACGGCGCCCCCCTCTACCATCACCCACCTCACCTCATCACCTTTCGTTGCGCGTCCCAAAACTAACCCCAACGA[T/C,TCTCTCGAC]
TCGATCCACCGCGCGATGTATCTCTTATATTTATTTACAATCTGTAGGCAGCCTCCCTCGTTTCGTGTTTGTATCCAAATCGGAATCATTATAGATTAAT

Reverse complement sequence

ATTAATCTATAATGATTCCGATTTGGATACAAACACGAAACGAGGGAGGCTGCCTACAGATTGTAAATAAATATAAGAGATACATCGCGCGGTGGATCGA[A/G,GTCGAGAGA]
TCGTTGGGGTTAGTTTTGGGACGCGCAACGAAAGGTGATGAGGTGAGGTGGGTGATGGTAGAGGGGGGCGCCGTTTTGGACGACCCCAAGCGGCCACCGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.20% 33.50% 0.53% 0.78% NA
All Indica  2759 46.20% 52.00% 0.47% 1.27% NA
All Japonica  1512 96.80% 2.40% 0.73% 0.13% NA
Aus  269 66.20% 33.80% 0.00% 0.00% NA
Indica I  595 38.20% 59.00% 1.01% 1.85% NA
Indica II  465 80.40% 18.50% 0.43% 0.65% NA
Indica III  913 29.90% 68.80% 0.22% 1.10% NA
Indica Intermediate  786 51.10% 47.10% 0.38% 1.40% NA
Temperate Japonica  767 99.70% 0.00% 0.00% 0.26% NA
Tropical Japonica  504 91.70% 6.20% 2.18% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 80.00% 18.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0600457865 T -> C LOC_Os06g01780.1 downstream_gene_variant ; 4131.0bp to feature; MODIFIER silent_mutation Average:70.644; most accessible tissue: Zhenshan97 root, score: 80.448 N N N N
vg0600457865 T -> C LOC_Os06g01790.1 downstream_gene_variant ; 285.0bp to feature; MODIFIER silent_mutation Average:70.644; most accessible tissue: Zhenshan97 root, score: 80.448 N N N N
vg0600457865 T -> C LOC_Os06g01800.1 downstream_gene_variant ; 3272.0bp to feature; MODIFIER silent_mutation Average:70.644; most accessible tissue: Zhenshan97 root, score: 80.448 N N N N
vg0600457865 T -> C LOC_Os06g01790-LOC_Os06g01800 intergenic_region ; MODIFIER silent_mutation Average:70.644; most accessible tissue: Zhenshan97 root, score: 80.448 N N N N
vg0600457865 T -> DEL N N silent_mutation Average:70.644; most accessible tissue: Zhenshan97 root, score: 80.448 N N N N
vg0600457865 T -> TCTCTCGAC LOC_Os06g01780.1 downstream_gene_variant ; 4132.0bp to feature; MODIFIER N Average:70.644; most accessible tissue: Zhenshan97 root, score: 80.448 N N N N
vg0600457865 T -> TCTCTCGAC LOC_Os06g01790.1 downstream_gene_variant ; 286.0bp to feature; MODIFIER N Average:70.644; most accessible tissue: Zhenshan97 root, score: 80.448 N N N N
vg0600457865 T -> TCTCTCGAC LOC_Os06g01800.1 downstream_gene_variant ; 3271.0bp to feature; MODIFIER N Average:70.644; most accessible tissue: Zhenshan97 root, score: 80.448 N N N N
vg0600457865 T -> TCTCTCGAC LOC_Os06g01790-LOC_Os06g01800 intergenic_region ; MODIFIER N Average:70.644; most accessible tissue: Zhenshan97 root, score: 80.448 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0600457865 NA 2.48E-20 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0600457865 NA 1.49E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865 NA 3.93E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865 NA 3.96E-06 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865 NA 2.43E-06 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865 NA 2.42E-06 mr1477 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865 NA 3.32E-06 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865 NA 6.57E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865 NA 2.88E-06 mr1971 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865 NA 3.02E-07 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865 NA 2.67E-06 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865 NA 1.35E-06 mr1165_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865 NA 7.51E-07 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865 NA 1.03E-07 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865 NA 5.17E-08 mr1268_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865 NA 1.31E-08 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865 NA 1.30E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865 NA 1.87E-09 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865 NA 2.56E-07 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865 NA 3.73E-11 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865 NA 6.89E-09 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865 NA 1.16E-10 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865 NA 7.73E-11 mr1971_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251