Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0600457865:

Variant ID: vg0600457865 (JBrowse)	Variation Type: INDEL
Chromosome: chr06	Position: 457865
Reference Allele: T	Alternative Allele: C,TCTCTCGAC
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACGGTGGCCGCTTGGGGTCGTCCAAAACGGCGCCCCCCTCTACCATCACCCACCTCACCTCATCACCTTTCGTTGCGCGTCCCAAAACTAACCCCAACGA[T/C,TCTCTCGAC]
TCGATCCACCGCGCGATGTATCTCTTATATTTATTTACAATCTGTAGGCAGCCTCCCTCGTTTCGTGTTTGTATCCAAATCGGAATCATTATAGATTAAT

Reverse complement sequence

ATTAATCTATAATGATTCCGATTTGGATACAAACACGAAACGAGGGAGGCTGCCTACAGATTGTAAATAAATATAAGAGATACATCGCGCGGTGGATCGA[A/G,GTCGAGAGA]
TCGTTGGGGTTAGTTTTGGGACGCGCAACGAAAGGTGATGAGGTGAGGTGGGTGATGGTAGAGGGGGGCGCCGTTTTGGACGACCCCAAGCGGCCACCGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.20%	33.50%	0.53%	0.78%	NA
All Indica	2759	46.20%	52.00%	0.47%	1.27%	NA
All Japonica	1512	96.80%	2.40%	0.73%	0.13%	NA
Aus	269	66.20%	33.80%	0.00%	0.00%	NA
Indica I	595	38.20%	59.00%	1.01%	1.85%	NA
Indica II	465	80.40%	18.50%	0.43%	0.65%	NA
Indica III	913	29.90%	68.80%	0.22%	1.10%	NA
Indica Intermediate	786	51.10%	47.10%	0.38%	1.40%	NA
Temperate Japonica	767	99.70%	0.00%	0.00%	0.26%	NA
Tropical Japonica	504	91.70%	6.20%	2.18%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	80.00%	18.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0600457865	T -> C	LOC_Os06g01780.1	downstream_gene_variant ; 4131.0bp to feature; MODIFIER	silent_mutation	Average:70.644; most accessible tissue: Zhenshan97 root, score: 80.448	N	N	N	N
vg0600457865	T -> C	LOC_Os06g01790.1	downstream_gene_variant ; 285.0bp to feature; MODIFIER	silent_mutation	Average:70.644; most accessible tissue: Zhenshan97 root, score: 80.448	N	N	N	N
vg0600457865	T -> C	LOC_Os06g01800.1	downstream_gene_variant ; 3272.0bp to feature; MODIFIER	silent_mutation	Average:70.644; most accessible tissue: Zhenshan97 root, score: 80.448	N	N	N	N
vg0600457865	T -> C	LOC_Os06g01790-LOC_Os06g01800	intergenic_region ; MODIFIER	silent_mutation	Average:70.644; most accessible tissue: Zhenshan97 root, score: 80.448	N	N	N	N
vg0600457865	T -> DEL	N	N	silent_mutation	Average:70.644; most accessible tissue: Zhenshan97 root, score: 80.448	N	N	N	N
vg0600457865	T -> TCTCTCGAC	LOC_Os06g01780.1	downstream_gene_variant ; 4132.0bp to feature; MODIFIER	N	Average:70.644; most accessible tissue: Zhenshan97 root, score: 80.448	N	N	N	N
vg0600457865	T -> TCTCTCGAC	LOC_Os06g01790.1	downstream_gene_variant ; 286.0bp to feature; MODIFIER	N	Average:70.644; most accessible tissue: Zhenshan97 root, score: 80.448	N	N	N	N
vg0600457865	T -> TCTCTCGAC	LOC_Os06g01800.1	downstream_gene_variant ; 3271.0bp to feature; MODIFIER	N	Average:70.644; most accessible tissue: Zhenshan97 root, score: 80.448	N	N	N	N
vg0600457865	T -> TCTCTCGAC	LOC_Os06g01790-LOC_Os06g01800	intergenic_region ; MODIFIER	N	Average:70.644; most accessible tissue: Zhenshan97 root, score: 80.448	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0600457865	NA	2.48E-20	Plant_height	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0600457865	NA	1.49E-06	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865	NA	3.93E-06	mr1044	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865	NA	3.96E-06	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865	NA	2.43E-06	mr1165	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865	NA	2.42E-06	mr1477	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865	NA	3.32E-06	mr1478	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865	NA	6.57E-06	mr1627	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865	NA	2.88E-06	mr1971	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865	NA	3.02E-07	mr1002_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865	NA	2.67E-06	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865	NA	1.35E-06	mr1165_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865	NA	7.51E-07	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865	NA	1.03E-07	mr1183_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865	NA	5.17E-08	mr1268_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865	NA	1.31E-08	mr1268_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865	NA	1.30E-06	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865	NA	1.87E-09	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865	NA	2.56E-07	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865	NA	3.73E-11	mr1478_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865	NA	6.89E-09	mr1478_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865	NA	1.16E-10	mr1627_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600457865	NA	7.73E-11	mr1971_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251