\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0600209076:

Variant ID: vg0600209076 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 209076
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGTAACTTGAGAGAAAACTTCATAAGAAGATAAAAAAGACATGTATAACCTAATAGCAAAAAAATAGTTGCATATATGTGAGGTGCAATAGTACTTCTC[G/C]
CACGTATTGCGCTGTCGCCTAGCAGGAGATGTCTCTCGAAATAGATTTTGCGCAATTTAATATATATTTTTTTAGACGGAGAGGGTAATAGTCGAGAAGG

Reverse complement sequence

CCTTCTCGACTATTACCCTCTCCGTCTAAAAAAATATATATTAAATTGCGCAAAATCTATTTCGAGAGACATCTCCTGCTAGGCGACAGCGCAATACGTG[C/G]
GAGAAGTACTATTGCACCTCACATATATGCAACTATTTTTTTGCTATTAGGTTATACATGTCTTTTTTATCTTCTTATGAAGTTTTCTCTCAAGTTACTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.50% 40.20% 0.04% 3.22% NA
All Indica  2759 35.50% 59.90% 0.04% 4.53% NA
All Japonica  1512 97.60% 0.70% 0.00% 1.72% NA
Aus  269 48.30% 51.70% 0.00% 0.00% NA
Indica I  595 6.40% 93.60% 0.00% 0.00% NA
Indica II  465 53.30% 45.40% 0.00% 1.29% NA
Indica III  913 40.40% 49.00% 0.11% 10.51% NA
Indica Intermediate  786 41.20% 55.90% 0.00% 2.93% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 94.20% 0.80% 0.00% 4.96% NA
Japonica Intermediate  241 97.10% 2.50% 0.00% 0.41% NA
VI/Aromatic  96 26.00% 74.00% 0.00% 0.00% NA
Intermediate  90 67.80% 30.00% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0600209076 G -> C LOC_Os06g01340.1 upstream_gene_variant ; 128.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0600209076 G -> C LOC_Os06g01350.1 upstream_gene_variant ; 3837.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0600209076 G -> C LOC_Os06g01320.1 downstream_gene_variant ; 493.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0600209076 G -> C LOC_Os06g01320-LOC_Os06g01340 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0600209076 G -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0600209076 G C 0.04 0.0 -0.02 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0600209076 NA 7.55E-07 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600209076 NA 7.18E-09 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600209076 NA 1.29E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600209076 3.41E-07 2.66E-10 mr1252 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600209076 NA 8.09E-06 mr1254 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600209076 NA 1.29E-14 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600209076 NA 6.74E-08 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600209076 NA 4.90E-06 mr1525 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600209076 7.97E-07 1.79E-08 mr1552 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600209076 NA 1.18E-06 mr1928 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600209076 NA 2.68E-07 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600209076 NA 9.56E-08 mr1155_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600209076 NA 5.09E-06 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600209076 NA 2.57E-09 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600209076 NA 6.65E-09 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600209076 NA 9.53E-06 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251