Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0600130622:

Variant ID: vg0600130622 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 130622
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


GAGGCCGTGGCGGCACTATCCATTGGTCGTCACCCCTTCCAGTTCGTGGTGTGATGTGAAGAGGCGTGCCTCCGCCATCGCCATCGAGCATGGCAGACAT[C/T]
ATTTCCTTGTCCTCGATTGTTTGCGCACCTCCACCACATTTGCTACCGCAGAGATCGAAGATATGAGGAGAGAGATAAGGTAGAATATTTGTTTCAATGA

Reverse complement sequence

TCATTGAAACAAATATTCTACCTTATCTCTCTCCTCATATCTTCGATCTCTGCGGTAGCAAATGTGGTGGAGGTGCGCAAACAATCGAGGACAAGGAAAT[G/A]
ATGTCTGCCATGCTCGATGGCGATGGCGGAGGCACGCCTCTTCACATCACACCACGAACTGGAAGGGGTGACGACCAATGGATAGTGCCGCCACGGCCTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.90% 38.80% 0.04% 0.19% NA
All Indica  2759 89.20% 10.50% 0.00% 0.25% NA
All Japonica  1512 2.90% 97.00% 0.07% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 99.30% 0.20% 0.00% 0.50% NA
Indica II  465 71.20% 28.60% 0.00% 0.22% NA
Indica III  913 94.50% 5.50% 0.00% 0.00% NA
Indica Intermediate  786 86.10% 13.50% 0.00% 0.38% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 6.90% 92.90% 0.20% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 77.10% 22.90% 0.00% 0.00% NA
Intermediate  90 36.70% 60.00% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0600130622 C -> T LOC_Os06g01160.1 missense_variant ; p.Met39Ile; MODERATE nonsynonymous_codon ; M39I Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 unknown unknown DELETERIOUS 0.00
vg0600130622 C -> DEL LOC_Os06g01160.1 N frameshift_variant Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0600130622 C T -0.01 -0.02 -0.02 -0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0600130622 NA 1.45E-21 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600130622 NA 7.35E-27 mr1148 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600130622 NA 5.54E-07 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600130622 NA 1.27E-08 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600130622 NA 1.46E-11 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600130622 NA 5.26E-08 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600130622 NA 9.41E-06 mr1668 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600130622 NA 3.27E-11 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600130622 NA 1.48E-08 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600130622 NA 2.21E-09 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600130622 NA 4.73E-16 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600130622 NA 5.57E-12 mr1986 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600130622 NA 1.19E-09 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251