Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0600116582:

Variant ID: vg0600116582 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 116582
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTAAAGGTATGATACTTGTGTTTGAGCTAGTAAGCCCCTGAGCACATAGTCACAATTGTTCATTGATGGTAGCTGACGCAGTTGGCATAGAGACAAGAC[T/G]
ACCAATATAGAGGCGAAGAAACCAGTCGGCAACAGTCAGGTCAGCCAGCAATGAATATGAAGGCGCCCAGCGATAAAGTTGTGTAGCCATGGCAGTGAAA

Reverse complement sequence

TTTCACTGCCATGGCTACACAACTTTATCGCTGGGCGCCTTCATATTCATTGCTGGCTGACCTGACTGTTGCCGACTGGTTTCTTCGCCTCTATATTGGT[A/C]
GTCTTGTCTCTATGCCAACTGCGTCAGCTACCATCAATGAACAATTGTGACTATGTGCTCAGGGGCTTACTAGCTCAAACACAAGTATCATACCTTTAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.10%	36.10%	17.35%	2.43%	NA
All Indica	2759	64.40%	7.20%	26.06%	2.39%	NA
All Japonica	1512	2.60%	94.80%	2.38%	0.26%	NA
Aus	269	91.40%	0.70%	6.32%	1.49%	NA
Indica I	595	69.70%	2.40%	25.55%	2.35%	NA
Indica II	465	53.80%	12.90%	32.26%	1.08%	NA
Indica III	913	68.80%	5.80%	23.00%	2.41%	NA
Indica Intermediate	786	61.50%	9.00%	26.34%	3.18%	NA
Temperate Japonica	767	0.00%	100.00%	0.00%	0.00%	NA
Tropical Japonica	504	7.10%	86.10%	6.75%	0.00%	NA
Japonica Intermediate	241	1.20%	96.30%	0.83%	1.66%	NA
VI/Aromatic	96	4.20%	22.90%	33.33%	39.58%	NA
Intermediate	90	22.20%	56.70%	17.78%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0600116582	T -> G	LOC_Os06g01130.1	upstream_gene_variant ; 2689.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0600116582	T -> G	LOC_Os06g01130-LOC_Os06g01140	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0600116582	T -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0600116582	NA	7.30E-06	mr1134	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600116582	NA	1.54E-06	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600116582	NA	1.32E-15	mr1361	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600116582	NA	5.85E-07	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600116582	NA	5.45E-14	mr1653	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600116582	NA	9.57E-06	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600116582	9.52E-06	2.95E-06	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600116582	2.63E-06	NA	mr1402_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251