Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0529913786:

Variant ID: vg0529913786 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 29913786
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, G: 0.06, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

ATCTGATACCGAGTTGAATATTTCACTCCTTGCCTTCATGGAAACACTTTTACCTAGGTCATCTTGCTTTCTCATGATGATTTTTTTTTACCTCAATGAC[A/G]
AGGTGACTGTTGCGGGGCAATTACTATCAGTGGTCTTCCTTGAGCGATGCAGAGCATGTTTCTGTTTATCCTTTATCAATCACCTTTCAGCCTAATTCTT

Reverse complement sequence

AAGAATTAGGCTGAAAGGTGATTGATAAAGGATAAACAGAAACATGCTCTGCATCGCTCAAGGAAGACCACTGATAGTAATTGCCCCGCAACAGTCACCT[T/C]
GTCATTGAGGTAAAAAAAAATCATCATGAGAAAGCAAGATGACCTAGGTAAAAGTGTTTCCATGAAGGCAAGGAGTGAAATATTCAACTCGGTATCAGAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.80%	20.80%	6.96%	2.50%	NA
All Indica	2759	52.00%	34.60%	9.28%	4.17%	NA
All Japonica	1512	95.40%	0.70%	3.84%	0.00%	NA
Aus	269	94.80%	1.10%	3.35%	0.74%	NA
Indica I	595	77.50%	11.40%	10.25%	0.84%	NA
Indica II	465	56.10%	36.80%	6.24%	0.86%	NA
Indica III	913	29.90%	49.90%	11.28%	8.87%	NA
Indica Intermediate	786	55.90%	33.00%	8.02%	3.18%	NA
Temperate Japonica	767	93.10%	0.90%	6.00%	0.00%	NA
Tropical Japonica	504	97.80%	0.20%	1.98%	0.00%	NA
Japonica Intermediate	241	97.90%	1.20%	0.83%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	78.90%	13.30%	6.67%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0529913786	A -> DEL	N	N	silent_mutation	Average:34.119; most accessible tissue: Zhenshan97 flag leaf, score: 57.42	N	N	N	N
vg0529913786	A -> G	LOC_Os05g52070.1	upstream_gene_variant ; 4155.0bp to feature; MODIFIER	silent_mutation	Average:34.119; most accessible tissue: Zhenshan97 flag leaf, score: 57.42	N	N	N	N
vg0529913786	A -> G	LOC_Os05g52080.1	downstream_gene_variant ; 1941.0bp to feature; MODIFIER	silent_mutation	Average:34.119; most accessible tissue: Zhenshan97 flag leaf, score: 57.42	N	N	N	N
vg0529913786	A -> G	LOC_Os05g52090.1	downstream_gene_variant ; 788.0bp to feature; MODIFIER	silent_mutation	Average:34.119; most accessible tissue: Zhenshan97 flag leaf, score: 57.42	N	N	N	N
vg0529913786	A -> G	LOC_Os05g52080-LOC_Os05g52090	intergenic_region ; MODIFIER	silent_mutation	Average:34.119; most accessible tissue: Zhenshan97 flag leaf, score: 57.42	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0529913786	NA	2.59E-10	Heading_date	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0529913786	NA	9.06E-07	mr1221	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529913786	NA	3.94E-07	mr1261	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529913786	NA	1.87E-06	mr1500	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529913786	NA	1.22E-07	mr1807	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529913786	NA	9.19E-06	mr1295_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251