\
| Variant ID: vg0529913786 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 29913786 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, G: 0.06, others allele: 0.00, population size: 82. )
ATCTGATACCGAGTTGAATATTTCACTCCTTGCCTTCATGGAAACACTTTTACCTAGGTCATCTTGCTTTCTCATGATGATTTTTTTTTACCTCAATGAC[A/G]
AGGTGACTGTTGCGGGGCAATTACTATCAGTGGTCTTCCTTGAGCGATGCAGAGCATGTTTCTGTTTATCCTTTATCAATCACCTTTCAGCCTAATTCTT
AAGAATTAGGCTGAAAGGTGATTGATAAAGGATAAACAGAAACATGCTCTGCATCGCTCAAGGAAGACCACTGATAGTAATTGCCCCGCAACAGTCACCT[T/C]
GTCATTGAGGTAAAAAAAAATCATCATGAGAAAGCAAGATGACCTAGGTAAAAGTGTTTCCATGAAGGCAAGGAGTGAAATATTCAACTCGGTATCAGAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.80% | 20.80% | 6.96% | 2.50% | NA |
| All Indica | 2759 | 52.00% | 34.60% | 9.28% | 4.17% | NA |
| All Japonica | 1512 | 95.40% | 0.70% | 3.84% | 0.00% | NA |
| Aus | 269 | 94.80% | 1.10% | 3.35% | 0.74% | NA |
| Indica I | 595 | 77.50% | 11.40% | 10.25% | 0.84% | NA |
| Indica II | 465 | 56.10% | 36.80% | 6.24% | 0.86% | NA |
| Indica III | 913 | 29.90% | 49.90% | 11.28% | 8.87% | NA |
| Indica Intermediate | 786 | 55.90% | 33.00% | 8.02% | 3.18% | NA |
| Temperate Japonica | 767 | 93.10% | 0.90% | 6.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.80% | 0.20% | 1.98% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 1.20% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 13.30% | 6.67% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0529913786 | A -> DEL | N | N | silent_mutation | Average:34.119; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 | N | N | N | N |
| vg0529913786 | A -> G | LOC_Os05g52070.1 | upstream_gene_variant ; 4155.0bp to feature; MODIFIER | silent_mutation | Average:34.119; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 | N | N | N | N |
| vg0529913786 | A -> G | LOC_Os05g52080.1 | downstream_gene_variant ; 1941.0bp to feature; MODIFIER | silent_mutation | Average:34.119; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 | N | N | N | N |
| vg0529913786 | A -> G | LOC_Os05g52090.1 | downstream_gene_variant ; 788.0bp to feature; MODIFIER | silent_mutation | Average:34.119; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 | N | N | N | N |
| vg0529913786 | A -> G | LOC_Os05g52080-LOC_Os05g52090 | intergenic_region ; MODIFIER | silent_mutation | Average:34.119; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0529913786 | NA | 2.59E-10 | Heading_date | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0529913786 | NA | 9.06E-07 | mr1221 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529913786 | NA | 3.94E-07 | mr1261 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529913786 | NA | 1.87E-06 | mr1500 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529913786 | NA | 1.22E-07 | mr1807 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529913786 | NA | 9.19E-06 | mr1295_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |