\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0529544194:

Variant ID: vg0529544194 (JBrowse)Variation Type: INDEL
Chromosome: chr05Position: 29544194
Reference Allele: CAAlternative Allele: TA,C
Primary Allele: TASecondary Allele: CA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTAATAAGACTTAATAGATTCGTCTCACAGTTTACAGGCGGAATCTGTAATTTTTTTATTAGTCTACATTTAATACTTTAAATGTGTTTTCGTATACGT[CA/TA,C]
AAATTTTTTTTTTGCCAAAACAACTAAACATGGCCTTATTCAAAAAAATTGTGCAAATATAAAAAACGAAAAGCTGTGACTAAAGTAATTTGGATAATAA

Reverse complement sequence

TTATTATCCAAATTACTTTAGTCACAGCTTTTCGTTTTTTATATTTGCACAATTTTTTTGAATAAGGCCATGTTTAGTTGTTTTGGCAAAAAAAAAATTT[TG/TA,G]
ACGTATACGAAAACACATTTAAAGTATTAAATGTAGACTAATAAAAAAATTACAGATTCCGCCTGTAAACTGTGAGACGAATCTATTAAGTCTTATTAAT

Allele Frequencies:

Populations Population SizeFrequency of TA(primary allele) Frequency of CA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.40% 45.40% 5.48% 2.29% C: 0.47%
All Indica  2759 77.20% 20.50% 1.27% 1.01% C: 0.04%
All Japonica  1512 0.60% 79.10% 13.82% 5.22% C: 1.26%
Aus  269 3.30% 96.70% 0.00% 0.00% NA
Indica I  595 88.10% 10.90% 0.67% 0.34% NA
Indica II  465 76.30% 15.90% 3.66% 4.09% NA
Indica III  913 76.60% 23.00% 0.33% 0.00% C: 0.11%
Indica Intermediate  786 70.10% 27.60% 1.40% 0.89% NA
Temperate Japonica  767 0.50% 94.10% 3.39% 0.78% C: 1.17%
Tropical Japonica  504 0.80% 54.00% 31.15% 13.10% C: 0.99%
Japonica Intermediate  241 0.40% 83.80% 10.79% 2.90% C: 2.07%
VI/Aromatic  96 9.40% 82.30% 6.25% 0.00% C: 2.08%
Intermediate  90 38.90% 50.00% 10.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0529544194 CA -> DEL N N silent_mutation Average:77.225; most accessible tissue: Minghui63 root, score: 86.064 N N N N
vg0529544194 CA -> TA LOC_Os05g51510.1 upstream_gene_variant ; 2175.0bp to feature; MODIFIER silent_mutation Average:77.225; most accessible tissue: Minghui63 root, score: 86.064 N N N N
vg0529544194 CA -> TA LOC_Os05g51510.2 upstream_gene_variant ; 2175.0bp to feature; MODIFIER silent_mutation Average:77.225; most accessible tissue: Minghui63 root, score: 86.064 N N N N
vg0529544194 CA -> TA LOC_Os05g51520.1 downstream_gene_variant ; 904.0bp to feature; MODIFIER silent_mutation Average:77.225; most accessible tissue: Minghui63 root, score: 86.064 N N N N
vg0529544194 CA -> TA LOC_Os05g51530.1 downstream_gene_variant ; 3257.0bp to feature; MODIFIER silent_mutation Average:77.225; most accessible tissue: Minghui63 root, score: 86.064 N N N N
vg0529544194 CA -> TA LOC_Os05g51530.2 downstream_gene_variant ; 3257.0bp to feature; MODIFIER silent_mutation Average:77.225; most accessible tissue: Minghui63 root, score: 86.064 N N N N
vg0529544194 CA -> TA LOC_Os05g51510-LOC_Os05g51520 intergenic_region ; MODIFIER silent_mutation Average:77.225; most accessible tissue: Minghui63 root, score: 86.064 N N N N
vg0529544194 CA -> C LOC_Os05g51510.1 upstream_gene_variant ; 2176.0bp to feature; MODIFIER silent_mutation Average:77.225; most accessible tissue: Minghui63 root, score: 86.064 N N N N
vg0529544194 CA -> C LOC_Os05g51510.2 upstream_gene_variant ; 2176.0bp to feature; MODIFIER silent_mutation Average:77.225; most accessible tissue: Minghui63 root, score: 86.064 N N N N
vg0529544194 CA -> C LOC_Os05g51520.1 downstream_gene_variant ; 903.0bp to feature; MODIFIER silent_mutation Average:77.225; most accessible tissue: Minghui63 root, score: 86.064 N N N N
vg0529544194 CA -> C LOC_Os05g51530.1 downstream_gene_variant ; 3256.0bp to feature; MODIFIER silent_mutation Average:77.225; most accessible tissue: Minghui63 root, score: 86.064 N N N N
vg0529544194 CA -> C LOC_Os05g51530.2 downstream_gene_variant ; 3256.0bp to feature; MODIFIER silent_mutation Average:77.225; most accessible tissue: Minghui63 root, score: 86.064 N N N N
vg0529544194 CA -> C LOC_Os05g51510-LOC_Os05g51520 intergenic_region ; MODIFIER silent_mutation Average:77.225; most accessible tissue: Minghui63 root, score: 86.064 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0529544194 CA C 0.03 0.01 -0.04 0.02 0.01 0.02
vg0529544194 CA TA 0.01 0.01 0.02 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0529544194 NA 3.44E-27 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 8.73E-51 mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 1.83E-18 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 2.04E-30 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 2.15E-10 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 3.68E-18 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 4.76E-08 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 4.44E-32 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 1.20E-08 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 1.63E-07 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 1.42E-13 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 2.08E-32 mr1037_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 9.79E-58 mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 3.05E-51 mr1121_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 2.29E-36 mr1208_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 8.70E-25 mr1244_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 7.88E-22 mr1253_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 2.81E-22 mr1316_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 7.13E-11 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 4.82E-07 mr1349_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 3.46E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 5.37E-06 mr1452_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 1.02E-06 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 4.31E-06 1.17E-10 mr1588_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 3.46E-36 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 4.75E-13 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 1.91E-10 mr1718_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 1.71E-14 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 1.47E-48 mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 9.91E-42 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 5.35E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 6.92E-09 mr1828_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 2.87E-34 mr1932_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 2.07E-09 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 2.07E-09 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 9.52E-64 mr1970_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194 NA 5.70E-95 mr1973_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251