Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0529544194:

Variant ID: vg0529544194 (JBrowse)	Variation Type: INDEL
Chromosome: chr05	Position: 29544194
Reference Allele: CA	Alternative Allele: TA,C
Primary Allele: TA	Secondary Allele: CA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTAATAAGACTTAATAGATTCGTCTCACAGTTTACAGGCGGAATCTGTAATTTTTTTATTAGTCTACATTTAATACTTTAAATGTGTTTTCGTATACGT[CA/TA,C]
AAATTTTTTTTTTGCCAAAACAACTAAACATGGCCTTATTCAAAAAAATTGTGCAAATATAAAAAACGAAAAGCTGTGACTAAAGTAATTTGGATAATAA

Reverse complement sequence

TTATTATCCAAATTACTTTAGTCACAGCTTTTCGTTTTTTATATTTGCACAATTTTTTTGAATAAGGCCATGTTTAGTTGTTTTGGCAAAAAAAAAATTT[TG/TA,G]
ACGTATACGAAAACACATTTAAAGTATTAAATGTAGACTAATAAAAAAATTACAGATTCCGCCTGTAAACTGTGAGACGAATCTATTAAGTCTTATTAAT

Allele Frequencies:

Populations	Population Size	Frequency of TA(primary allele)	Frequency of CA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.40%	45.40%	5.48%	2.29%	C: 0.47%
All Indica	2759	77.20%	20.50%	1.27%	1.01%	C: 0.04%
All Japonica	1512	0.60%	79.10%	13.82%	5.22%	C: 1.26%
Aus	269	3.30%	96.70%	0.00%	0.00%	NA
Indica I	595	88.10%	10.90%	0.67%	0.34%	NA
Indica II	465	76.30%	15.90%	3.66%	4.09%	NA
Indica III	913	76.60%	23.00%	0.33%	0.00%	C: 0.11%
Indica Intermediate	786	70.10%	27.60%	1.40%	0.89%	NA
Temperate Japonica	767	0.50%	94.10%	3.39%	0.78%	C: 1.17%
Tropical Japonica	504	0.80%	54.00%	31.15%	13.10%	C: 0.99%
Japonica Intermediate	241	0.40%	83.80%	10.79%	2.90%	C: 2.07%
VI/Aromatic	96	9.40%	82.30%	6.25%	0.00%	C: 2.08%
Intermediate	90	38.90%	50.00%	10.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0529544194	CA -> DEL	N	N	silent_mutation	Average:77.225; most accessible tissue: Minghui63 root, score: 86.064	N	N	N	N
vg0529544194	CA -> TA	LOC_Os05g51510.1	upstream_gene_variant ; 2175.0bp to feature; MODIFIER	silent_mutation	Average:77.225; most accessible tissue: Minghui63 root, score: 86.064	N	N	N	N
vg0529544194	CA -> TA	LOC_Os05g51510.2	upstream_gene_variant ; 2175.0bp to feature; MODIFIER	silent_mutation	Average:77.225; most accessible tissue: Minghui63 root, score: 86.064	N	N	N	N
vg0529544194	CA -> TA	LOC_Os05g51520.1	downstream_gene_variant ; 904.0bp to feature; MODIFIER	silent_mutation	Average:77.225; most accessible tissue: Minghui63 root, score: 86.064	N	N	N	N
vg0529544194	CA -> TA	LOC_Os05g51530.1	downstream_gene_variant ; 3257.0bp to feature; MODIFIER	silent_mutation	Average:77.225; most accessible tissue: Minghui63 root, score: 86.064	N	N	N	N
vg0529544194	CA -> TA	LOC_Os05g51530.2	downstream_gene_variant ; 3257.0bp to feature; MODIFIER	silent_mutation	Average:77.225; most accessible tissue: Minghui63 root, score: 86.064	N	N	N	N
vg0529544194	CA -> TA	LOC_Os05g51510-LOC_Os05g51520	intergenic_region ; MODIFIER	silent_mutation	Average:77.225; most accessible tissue: Minghui63 root, score: 86.064	N	N	N	N
vg0529544194	CA -> C	LOC_Os05g51510.1	upstream_gene_variant ; 2176.0bp to feature; MODIFIER	silent_mutation	Average:77.225; most accessible tissue: Minghui63 root, score: 86.064	N	N	N	N
vg0529544194	CA -> C	LOC_Os05g51510.2	upstream_gene_variant ; 2176.0bp to feature; MODIFIER	silent_mutation	Average:77.225; most accessible tissue: Minghui63 root, score: 86.064	N	N	N	N
vg0529544194	CA -> C	LOC_Os05g51520.1	downstream_gene_variant ; 903.0bp to feature; MODIFIER	silent_mutation	Average:77.225; most accessible tissue: Minghui63 root, score: 86.064	N	N	N	N
vg0529544194	CA -> C	LOC_Os05g51530.1	downstream_gene_variant ; 3256.0bp to feature; MODIFIER	silent_mutation	Average:77.225; most accessible tissue: Minghui63 root, score: 86.064	N	N	N	N
vg0529544194	CA -> C	LOC_Os05g51530.2	downstream_gene_variant ; 3256.0bp to feature; MODIFIER	silent_mutation	Average:77.225; most accessible tissue: Minghui63 root, score: 86.064	N	N	N	N
vg0529544194	CA -> C	LOC_Os05g51510-LOC_Os05g51520	intergenic_region ; MODIFIER	silent_mutation	Average:77.225; most accessible tissue: Minghui63 root, score: 86.064	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0529544194	CA	C	0.03	0.01	-0.04	0.02	0.01	0.02
vg0529544194	CA	TA	0.01	0.01	0.02	0.01	0.01	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0529544194	NA	3.44E-27	mr1037	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	8.73E-51	mr1109	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	1.83E-18	mr1179	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	2.04E-30	mr1208	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	2.15E-10	mr1316	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	3.68E-18	mr1598	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	4.76E-08	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	4.44E-32	mr1745	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	1.20E-08	mr1827	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	1.63E-07	mr1836	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	1.42E-13	mr1914	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	2.08E-32	mr1037_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	9.79E-58	mr1109_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	3.05E-51	mr1121_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	2.29E-36	mr1208_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	8.70E-25	mr1244_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	7.88E-22	mr1253_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	2.81E-22	mr1316_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	7.13E-11	mr1349_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	4.82E-07	mr1349_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	3.46E-06	mr1428_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	5.37E-06	mr1452_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	1.02E-06	mr1478_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	4.31E-06	1.17E-10	mr1588_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	3.46E-36	mr1598_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	4.75E-13	mr1666_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	1.91E-10	mr1718_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	1.71E-14	mr1720_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	1.47E-48	mr1721_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	9.91E-42	mr1745_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	5.35E-10	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	6.92E-09	mr1828_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	2.87E-34	mr1932_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	2.07E-09	mr1946_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	2.07E-09	mr1948_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	9.52E-64	mr1970_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529544194	NA	5.70E-95	mr1973_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251