Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0529502181:

Variant ID: vg0529502181 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 29502181
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:

AGTGTATCTACAAGTGGCAACGAGGTGCAACGCCGTCTCAGCCTCACAGCGGCACAGAGGACAACATCCATTGTTTTGCCAACCCCTGGTCGCAAGTCGA[A/T]
CTGAGGTCCAGACTCTATTTTGGATGATGAGCCAAGCATGAAATTTACATTTCCCTAGTGCCCAGACTTTCCAGATTAAGGAGTTGAAGCTTGTGCTCGA

Reverse complement sequence

TCGAGCACAAGCTTCAACTCCTTAATCTGGAAAGTCTGGGCACTAGGGAAATGTAAATTTCATGCTTGGCTCATCATCCAAAATAGAGTCTGGACCTCAG[T/A]
TCGACTTGCGACCAGGGGTTGGCAAAACAATGGATGTTGTCCTCTGTGCCGCTGTGAGGCTGAGACGGCGTTGCACCTCGTTGCCACTTGTAGATACACT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.30%	22.70%	0.00%	0.00%	NA
All Indica	2759	98.50%	1.50%	0.00%	0.00%	NA
All Japonica	1512	38.80%	61.20%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	96.80%	3.20%	0.00%	0.00%	NA
Indica III	913	99.60%	0.40%	0.00%	0.00%	NA
Indica Intermediate	786	97.50%	2.50%	0.00%	0.00%	NA
Temperate Japonica	767	4.70%	95.30%	0.00%	0.00%	NA
Tropical Japonica	504	93.70%	6.30%	0.00%	0.00%	NA
Japonica Intermediate	241	32.40%	67.60%	0.00%	0.00%	NA
VI/Aromatic	96	16.70%	83.30%	0.00%	0.00%	NA
Intermediate	90	72.20%	27.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0529502181	A -> T	LOC_Os05g51450.1	upstream_gene_variant ; 2702.0bp to feature; MODIFIER	silent_mutation	Average:50.694; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg0529502181	A -> T	LOC_Os05g51470.1	upstream_gene_variant ; 4796.0bp to feature; MODIFIER	silent_mutation	Average:50.694; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg0529502181	A -> T	LOC_Os05g51460.1	downstream_gene_variant ; 401.0bp to feature; MODIFIER	silent_mutation	Average:50.694; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg0529502181	A -> T	LOC_Os05g51450-LOC_Os05g51460	intergenic_region ; MODIFIER	silent_mutation	Average:50.694; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0529502181	NA	2.10E-06	mr1359	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529502181	NA	6.92E-09	mr1449	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529502181	NA	1.03E-10	mr1471	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529502181	NA	2.08E-06	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529502181	NA	2.78E-07	mr1551	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529502181	NA	1.66E-09	mr1580	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529502181	NA	1.94E-06	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529502181	NA	5.71E-07	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529502181	NA	1.70E-06	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529502181	NA	9.61E-06	mr1816	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529502181	NA	2.87E-08	mr1864	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529502181	NA	1.30E-06	mr1870	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529502181	NA	6.27E-12	mr1879	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529502181	NA	1.73E-12	mr1879	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529502181	NA	8.70E-26	mr1304_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529502181	NA	9.70E-08	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529502181	NA	1.84E-08	mr1471_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529502181	NA	7.03E-18	mr1539_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529502181	NA	2.93E-18	mr1540_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529502181	NA	4.41E-21	mr1679_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529502181	NA	9.19E-08	mr1696_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529502181	NA	2.30E-17	mr1732_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529502181	NA	2.05E-12	mr1853_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529502181	NA	1.21E-06	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529502181	NA	1.17E-11	mr1879_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251