Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0529499648:

Variant ID: vg0529499648 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 29499648
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, T: 0.11, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

TCTCGTTTTCTTATTTTTACAAACATTATTTTTTTTCTTATTAAAATAAAAGAAAATTGCATATTACTCTCTCCGTTCCAAAATAAATCAATTTAAGATA[G/T]
GATGTGATATTTTCTGGTACTACAAATATAGATAAGAGCATATCAAAATTCATTATATAAAAAATATCCCATCACATATATTATTTTGAGATGGAGGAAG

Reverse complement sequence

CTTCCTCCATCTCAAAATAATATATGTGATGGGATATTTTTTATATAATGAATTTTGATATGCTCTTATCTATATTTGTAGTACCAGAAAATATCACATC[C/A]
TATCTTAAATTGATTTATTTTGGAACGGAGAGAGTAATATGCAATTTTCTTTTATTTTAATAAGAAAAAAAATAATGTTTGTAAAAATAAGAAAACGAGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.20%	36.70%	0.11%	0.00%	NA
All Indica	2759	95.20%	4.60%	0.14%	0.00%	NA
All Japonica	1512	2.40%	97.60%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.50%	1.30%	0.17%	0.00%	NA
Indica II	465	83.90%	16.10%	0.00%	0.00%	NA
Indica III	913	99.10%	0.80%	0.11%	0.00%	NA
Indica Intermediate	786	94.90%	4.80%	0.25%	0.00%	NA
Temperate Japonica	767	0.50%	99.50%	0.00%	0.00%	NA
Tropical Japonica	504	5.80%	94.20%	0.00%	0.00%	NA
Japonica Intermediate	241	1.20%	98.80%	0.00%	0.00%	NA
VI/Aromatic	96	10.40%	89.60%	0.00%	0.00%	NA
Intermediate	90	47.80%	51.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0529499648	G -> T	LOC_Os05g51450.1	upstream_gene_variant ; 169.0bp to feature; MODIFIER	silent_mutation	Average:83.911; most accessible tissue: Minghui63 flag leaf, score: 90.986	N	N	N	N
vg0529499648	G -> T	LOC_Os05g51440.1	downstream_gene_variant ; 3932.0bp to feature; MODIFIER	silent_mutation	Average:83.911; most accessible tissue: Minghui63 flag leaf, score: 90.986	N	N	N	N
vg0529499648	G -> T	LOC_Os05g51460.1	downstream_gene_variant ; 2934.0bp to feature; MODIFIER	silent_mutation	Average:83.911; most accessible tissue: Minghui63 flag leaf, score: 90.986	N	N	N	N
vg0529499648	G -> T	LOC_Os05g51450-LOC_Os05g51460	intergenic_region ; MODIFIER	silent_mutation	Average:83.911; most accessible tissue: Minghui63 flag leaf, score: 90.986	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0529499648	NA	1.44E-08	mr1005	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529499648	NA	1.48E-17	mr1133	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529499648	NA	1.43E-14	mr1146	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529499648	NA	8.74E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529499648	NA	7.80E-22	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529499648	NA	9.91E-06	mr1588	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529499648	NA	1.33E-06	mr1639	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529499648	NA	2.76E-06	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529499648	NA	3.46E-16	mr1162_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529499648	NA	2.48E-22	mr1175_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529499648	NA	7.86E-06	mr1186_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529499648	NA	7.78E-11	mr1349_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529499648	4.38E-06	1.12E-09	mr1349_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529499648	NA	4.76E-06	mr1428_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529499648	NA	1.99E-08	mr1478_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529499648	NA	2.14E-45	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529499648	NA	5.74E-30	mr1588_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529499648	NA	6.06E-11	mr1588_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529499648	NA	2.46E-18	mr1712_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529499648	NA	7.01E-13	mr1713_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529499648	NA	4.78E-11	mr1722_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529499648	NA	2.87E-07	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529499648	NA	4.29E-10	mr1756_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529499648	NA	1.21E-14	mr1790_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529499648	NA	2.24E-07	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529499648	NA	5.86E-08	mr1828_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529499648	NA	6.42E-22	mr1933_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251