\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0529485802:

Variant ID: vg0529485802 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 29485802
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.74, G: 0.26, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


CTCGACCATGAATTAATGGAGCGAATGAAACGGTACTAATGGATGAGATGGCGAAGTGTAGCTAGCTAGGGCCTAGAAGCGTTGAGTTAACATTGCCAGC[T/G]
GATATCATATCAAGATCACGAATGAGTATTCTCTACCATAATGTCACTACCATTATAACTATTGGTCTGTGGGTCTATTTTTCTGTTGCTCCACACATCA

Reverse complement sequence

TGATGTGTGGAGCAACAGAAAAATAGACCCACAGACCAATAGTTATAATGGTAGTGACATTATGGTAGAGAATACTCATTCGTGATCTTGATATGATATC[A/C]
GCTGGCAATGTTAACTCAACGCTTCTAGGCCCTAGCTAGCTACACTTCGCCATCTCATCCATTAGTACCGTTTCATTCGCTCCATTAATTCATGGTCGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.20% 36.60% 0.19% 0.00% NA
All Indica  2759 95.10% 4.60% 0.25% 0.00% NA
All Japonica  1512 2.40% 97.60% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.50% 1.30% 0.17% 0.00% NA
Indica II  465 83.40% 16.10% 0.43% 0.00% NA
Indica III  913 99.10% 0.70% 0.22% 0.00% NA
Indica Intermediate  786 94.90% 4.80% 0.25% 0.00% NA
Temperate Japonica  767 0.70% 99.30% 0.00% 0.00% NA
Tropical Japonica  504 5.80% 94.20% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 51.10% 46.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0529485802 T -> G LOC_Os05g51400.1 downstream_gene_variant ; 704.0bp to feature; MODIFIER silent_mutation Average:63.675; most accessible tissue: Callus, score: 87.307 N N N N
vg0529485802 T -> G LOC_Os05g51420.1 downstream_gene_variant ; 925.0bp to feature; MODIFIER silent_mutation Average:63.675; most accessible tissue: Callus, score: 87.307 N N N N
vg0529485802 T -> G LOC_Os05g51420.2 downstream_gene_variant ; 925.0bp to feature; MODIFIER silent_mutation Average:63.675; most accessible tissue: Callus, score: 87.307 N N N N
vg0529485802 T -> G LOC_Os05g51420.3 downstream_gene_variant ; 925.0bp to feature; MODIFIER silent_mutation Average:63.675; most accessible tissue: Callus, score: 87.307 N N N N
vg0529485802 T -> G LOC_Os05g51420.7 downstream_gene_variant ; 925.0bp to feature; MODIFIER silent_mutation Average:63.675; most accessible tissue: Callus, score: 87.307 N N N N
vg0529485802 T -> G LOC_Os05g51420.4 downstream_gene_variant ; 925.0bp to feature; MODIFIER silent_mutation Average:63.675; most accessible tissue: Callus, score: 87.307 N N N N
vg0529485802 T -> G LOC_Os05g51420.5 downstream_gene_variant ; 925.0bp to feature; MODIFIER silent_mutation Average:63.675; most accessible tissue: Callus, score: 87.307 N N N N
vg0529485802 T -> G LOC_Os05g51420.6 downstream_gene_variant ; 925.0bp to feature; MODIFIER silent_mutation Average:63.675; most accessible tissue: Callus, score: 87.307 N N N N
vg0529485802 T -> G LOC_Os05g51400-LOC_Os05g51420 intergenic_region ; MODIFIER silent_mutation Average:63.675; most accessible tissue: Callus, score: 87.307 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0529485802 NA 9.94E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802 NA 6.02E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802 NA 3.04E-22 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802 NA 6.41E-06 mr1588 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802 NA 5.76E-07 mr1639 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802 NA 6.24E-51 mr1935 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802 NA 1.08E-37 mr1072_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802 NA 1.67E-15 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802 NA 4.38E-21 mr1175_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802 NA 5.85E-19 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802 NA 7.95E-06 mr1349_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802 NA 3.85E-07 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802 NA 1.58E-44 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802 NA 1.08E-29 mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802 NA 5.59E-10 mr1588_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802 NA 2.83E-16 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802 NA 4.86E-07 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802 NA 1.36E-17 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802 NA 5.16E-13 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802 NA 4.55E-11 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802 NA 6.10E-08 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802 NA 2.27E-14 mr1790_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802 NA 5.18E-08 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802 NA 2.09E-08 mr1828_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251