Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0529485802:

Variant ID: vg0529485802 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 29485802
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.74, G: 0.26, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:

CTCGACCATGAATTAATGGAGCGAATGAAACGGTACTAATGGATGAGATGGCGAAGTGTAGCTAGCTAGGGCCTAGAAGCGTTGAGTTAACATTGCCAGC[T/G]
GATATCATATCAAGATCACGAATGAGTATTCTCTACCATAATGTCACTACCATTATAACTATTGGTCTGTGGGTCTATTTTTCTGTTGCTCCACACATCA

Reverse complement sequence

TGATGTGTGGAGCAACAGAAAAATAGACCCACAGACCAATAGTTATAATGGTAGTGACATTATGGTAGAGAATACTCATTCGTGATCTTGATATGATATC[A/C]
GCTGGCAATGTTAACTCAACGCTTCTAGGCCCTAGCTAGCTACACTTCGCCATCTCATCCATTAGTACCGTTTCATTCGCTCCATTAATTCATGGTCGAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.20%	36.60%	0.19%	0.00%	NA
All Indica	2759	95.10%	4.60%	0.25%	0.00%	NA
All Japonica	1512	2.40%	97.60%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.50%	1.30%	0.17%	0.00%	NA
Indica II	465	83.40%	16.10%	0.43%	0.00%	NA
Indica III	913	99.10%	0.70%	0.22%	0.00%	NA
Indica Intermediate	786	94.90%	4.80%	0.25%	0.00%	NA
Temperate Japonica	767	0.70%	99.30%	0.00%	0.00%	NA
Tropical Japonica	504	5.80%	94.20%	0.00%	0.00%	NA
Japonica Intermediate	241	1.20%	98.80%	0.00%	0.00%	NA
VI/Aromatic	96	11.50%	88.50%	0.00%	0.00%	NA
Intermediate	90	51.10%	46.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0529485802	T -> G	LOC_Os05g51400.1	downstream_gene_variant ; 704.0bp to feature; MODIFIER	silent_mutation	Average:63.675; most accessible tissue: Callus, score: 87.307	N	N	N	N
vg0529485802	T -> G	LOC_Os05g51420.1	downstream_gene_variant ; 925.0bp to feature; MODIFIER	silent_mutation	Average:63.675; most accessible tissue: Callus, score: 87.307	N	N	N	N
vg0529485802	T -> G	LOC_Os05g51420.2	downstream_gene_variant ; 925.0bp to feature; MODIFIER	silent_mutation	Average:63.675; most accessible tissue: Callus, score: 87.307	N	N	N	N
vg0529485802	T -> G	LOC_Os05g51420.3	downstream_gene_variant ; 925.0bp to feature; MODIFIER	silent_mutation	Average:63.675; most accessible tissue: Callus, score: 87.307	N	N	N	N
vg0529485802	T -> G	LOC_Os05g51420.7	downstream_gene_variant ; 925.0bp to feature; MODIFIER	silent_mutation	Average:63.675; most accessible tissue: Callus, score: 87.307	N	N	N	N
vg0529485802	T -> G	LOC_Os05g51420.4	downstream_gene_variant ; 925.0bp to feature; MODIFIER	silent_mutation	Average:63.675; most accessible tissue: Callus, score: 87.307	N	N	N	N
vg0529485802	T -> G	LOC_Os05g51420.5	downstream_gene_variant ; 925.0bp to feature; MODIFIER	silent_mutation	Average:63.675; most accessible tissue: Callus, score: 87.307	N	N	N	N
vg0529485802	T -> G	LOC_Os05g51420.6	downstream_gene_variant ; 925.0bp to feature; MODIFIER	silent_mutation	Average:63.675; most accessible tissue: Callus, score: 87.307	N	N	N	N
vg0529485802	T -> G	LOC_Os05g51400-LOC_Os05g51420	intergenic_region ; MODIFIER	silent_mutation	Average:63.675; most accessible tissue: Callus, score: 87.307	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0529485802	NA	9.94E-11	mr1281	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802	NA	6.02E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802	NA	3.04E-22	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802	NA	6.41E-06	mr1588	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802	NA	5.76E-07	mr1639	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802	NA	6.24E-51	mr1935	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802	NA	1.08E-37	mr1072_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802	NA	1.67E-15	mr1162_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802	NA	4.38E-21	mr1175_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802	NA	5.85E-19	mr1195_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802	NA	7.95E-06	mr1349_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802	NA	3.85E-07	mr1478_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802	NA	1.58E-44	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802	NA	1.08E-29	mr1588_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802	NA	5.59E-10	mr1588_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802	NA	2.83E-16	mr1592_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802	NA	4.86E-07	mr1654_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802	NA	1.36E-17	mr1712_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802	NA	5.16E-13	mr1713_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802	NA	4.55E-11	mr1722_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802	NA	6.10E-08	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802	NA	2.27E-14	mr1790_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802	NA	5.18E-08	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529485802	NA	2.09E-08	mr1828_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251