\
| Variant ID: vg0529437664 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 29437664 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 88. )
ATATCGCCTCTTGCTCAATCCAGAGAAATGCACGTTCGGAGTACCATCGGGCAAGCTGCTCGATTTCCTTGTCGCTGGCAGAGGAATAGAAGCAAATCCC[G/A]
AGAAGATCAAGGCAATCGAGAACATGAAATCACCCACAAGACTCAAGGAAGTACAAAAGCTAACCGGATGCATGGCAGCACTGAGCAGGTTCGTCGCTAG
CTAGCGACGAACCTGCTCAGTGCTGCCATGCATCCGGTTAGCTTTTGTACTTCCTTGAGTCTTGTGGGTGATTTCATGTTCTCGATTGCCTTGATCTTCT[C/T]
GGGATTTGCTTCTATTCCTCTGCCAGCGACAAGGAAATCGAGCAGCTTGCCCGATGGTACTCCGAACGTGCATTTCTCTGGATTGAGCAAGAGGCGATAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.80% | 35.70% | 0.11% | 0.36% | NA |
| All Indica | 2759 | 94.90% | 4.50% | 0.04% | 0.58% | NA |
| All Japonica | 1512 | 4.80% | 95.10% | 0.13% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.50% | 1.20% | 0.17% | 1.18% | NA |
| Indica II | 465 | 83.90% | 15.50% | 0.00% | 0.65% | NA |
| Indica III | 913 | 99.10% | 0.50% | 0.00% | 0.33% | NA |
| Indica Intermediate | 786 | 94.50% | 5.10% | 0.00% | 0.38% | NA |
| Temperate Japonica | 767 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 13.10% | 86.70% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.30% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 15.60% | 84.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 47.80% | 48.90% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0529437664 | G -> DEL | LOC_Os05g51320.1 | N | frameshift_variant | Average:32.236; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg0529437664 | G -> A | LOC_Os05g51320.1 | missense_variant ; p.Glu328Lys; MODERATE | nonsynonymous_codon ; E328K | Average:32.236; most accessible tissue: Zhenshan97 panicle, score: 49.416 | benign |
0.887 |
DELETERIOUS | 0.05 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0529437664 | NA | 1.18E-20 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529437664 | NA | 5.54E-06 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529437664 | NA | 8.92E-38 | mr1072_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529437664 | NA | 2.41E-17 | mr1162_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529437664 | NA | 2.93E-06 | mr1186_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529437664 | NA | 1.39E-18 | mr1195_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529437664 | NA | 5.14E-06 | mr1296_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529437664 | NA | 8.69E-06 | mr1332_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529437664 | NA | 4.40E-10 | mr1349_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529437664 | NA | 3.94E-07 | mr1349_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529437664 | NA | 1.85E-06 | mr1428_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529437664 | NA | 2.64E-06 | mr1439_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529437664 | NA | 3.01E-06 | mr1452_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529437664 | 2.34E-06 | 8.56E-09 | mr1452_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529437664 | NA | 3.33E-06 | mr1470_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529437664 | NA | 1.83E-06 | mr1478_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529437664 | NA | 2.37E-07 | mr1568_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529437664 | NA | 3.60E-29 | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529437664 | 3.85E-06 | 7.68E-09 | mr1588_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529437664 | NA | 5.74E-10 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529437664 | 8.88E-06 | 8.89E-06 | mr1666_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529437664 | NA | 2.20E-18 | mr1712_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529437664 | NA | 1.04E-12 | mr1722_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529437664 | NA | 7.57E-09 | mr1749_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529437664 | NA | 7.84E-10 | mr1761_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529437664 | 1.07E-06 | 1.43E-07 | mr1761_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529437664 | NA | 1.87E-14 | mr1790_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529437664 | NA | 1.54E-08 | mr1821_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529437664 | NA | 3.08E-11 | mr1893_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529437664 | NA | 3.88E-22 | mr1933_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529437664 | NA | 7.23E-09 | mr1946_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529437664 | NA | 7.23E-09 | mr1948_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |