\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0529385032:

Variant ID: vg0529385032 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 29385032
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.64, A: 0.36, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:


TTCAGATTTTCTCGTAACTATTTTGATCATCTACAAGAAACAGCACACTCCATTAACAGTACAAAACATTTTCCCTATAGAGCATCTTTACTATCTTTGA[A/G]
AAGGTACCATGAGGTAGCAATATAATCTAACCGTTGGTTTAGAAATGGGTATGATCGGGCTAAAGAAATTACCGTCGTTGCATCAAGGCTGTCGTGGCTG

Reverse complement sequence

CAGCCACGACAGCCTTGATGCAACGACGGTAATTTCTTTAGCCCGATCATACCCATTTCTAAACCAACGGTTAGATTATATTGCTACCTCATGGTACCTT[T/C]
TCAAAGATAGTAAAGATGCTCTATAGGGAAAATGTTTTGTACTGTTAATGGAGTGTGCTGTTTCTTGTAGATGATCAAAATAGTTACGAGAAAATCTGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.10% 35.60% 0.11% 0.21% NA
All Indica  2759 95.10% 4.50% 0.11% 0.25% NA
All Japonica  1512 4.80% 95.00% 0.00% 0.20% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 98.30% 1.20% 0.17% 0.34% NA
Indica II  465 83.40% 15.70% 0.00% 0.86% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 94.70% 5.00% 0.25% 0.13% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 13.10% 86.70% 0.00% 0.20% NA
Japonica Intermediate  241 1.70% 97.50% 0.00% 0.83% NA
VI/Aromatic  96 16.70% 82.30% 1.04% 0.00% NA
Intermediate  90 56.70% 42.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0529385032 A -> DEL N N silent_mutation Average:78.07; most accessible tissue: Zhenshan97 flag leaf, score: 97.97 N N N N
vg0529385032 A -> G LOC_Os05g51220.1 upstream_gene_variant ; 3533.0bp to feature; MODIFIER silent_mutation Average:78.07; most accessible tissue: Zhenshan97 flag leaf, score: 97.97 N N N N
vg0529385032 A -> G LOC_Os05g51230.1 downstream_gene_variant ; 494.0bp to feature; MODIFIER silent_mutation Average:78.07; most accessible tissue: Zhenshan97 flag leaf, score: 97.97 N N N N
vg0529385032 A -> G LOC_Os05g51240.1 downstream_gene_variant ; 884.0bp to feature; MODIFIER silent_mutation Average:78.07; most accessible tissue: Zhenshan97 flag leaf, score: 97.97 N N N N
vg0529385032 A -> G LOC_Os05g51230-LOC_Os05g51240 intergenic_region ; MODIFIER silent_mutation Average:78.07; most accessible tissue: Zhenshan97 flag leaf, score: 97.97 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0529385032 A G 0.01 0.01 0.03 -0.02 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0529385032 NA 1.05E-08 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529385032 NA 1.86E-10 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529385032 NA 1.61E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529385032 NA 1.05E-07 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529385032 NA 1.31E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529385032 NA 8.35E-09 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529385032 NA 1.72E-11 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529385032 2.74E-06 2.74E-06 mr1623 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529385032 NA 1.25E-08 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529385032 NA 1.57E-14 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529385032 NA 1.39E-27 mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529385032 NA 3.05E-07 mr1588_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529385032 NA 3.58E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529385032 NA 2.09E-07 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529385032 NA 1.26E-07 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529385032 NA 1.59E-10 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251