\
| Variant ID: vg0529371849 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 29371849 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 117. )
CTGGCGAGCGGGATGGAGTAGCCCACGAGCGACGGCGCAGCACAGAGGAGGAGGCAAACCCTAGATTGATTTCGTGTGTTTTGCGTGAAGGCGGCGGCTC[A/G]
GTTTATATAGGATAGGTCACTTGATCAGGGCGCCCGCACGATCTCCAGTCCGCGTAACCGAACCGGATAAGTCGCGCGTAACTTATCCGGACTCCATGCC
GGCATGGAGTCCGGATAAGTTACGCGCGACTTATCCGGTTCGGTTACGCGGACTGGAGATCGTGCGGGCGCCCTGATCAAGTGACCTATCCTATATAAAC[T/C]
GAGCCGCCGCCTTCACGCAAAACACACGAAATCAATCTAGGGTTTGCCTCCTCCTCTGTGCTGCGCCGTCGCTCGTGGGCTACTCCATCCCGCTCGCCAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.10% | 35.80% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 95.10% | 4.70% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 4.80% | 95.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.20% | 1.30% | 0.50% | 0.00% | NA |
| Indica II | 465 | 83.90% | 15.70% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.80% | 5.00% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 13.10% | 86.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 16.70% | 83.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 41.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0529371849 | A -> G | LOC_Os05g51200.1 | upstream_gene_variant ; 514.0bp to feature; MODIFIER | silent_mutation | Average:47.85; most accessible tissue: Minghui63 root, score: 65.927 | N | N | N | N |
| vg0529371849 | A -> G | LOC_Os05g51200-LOC_Os05g51210 | intergenic_region ; MODIFIER | silent_mutation | Average:47.85; most accessible tissue: Minghui63 root, score: 65.927 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0529371849 | NA | 5.96E-15 | mr1146 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529371849 | NA | 1.24E-08 | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529371849 | NA | 4.82E-21 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529371849 | NA | 2.44E-18 | mr1162_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529371849 | NA | 4.61E-16 | mr1342_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529371849 | NA | 5.68E-10 | mr1349_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529371849 | NA | 1.80E-06 | mr1349_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529371849 | NA | 8.54E-29 | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529371849 | NA | 1.50E-07 | mr1588_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529371849 | NA | 3.77E-07 | mr1654_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529371849 | NA | 3.09E-17 | mr1712_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529371849 | NA | 1.84E-12 | mr1722_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529371849 | NA | 6.47E-08 | mr1749_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0529371849 | NA | 1.79E-07 | mr1821_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |